NUDT22 cdna clone
NUDT22 cDNA Clone
Synonyms
NUDT22; NUDT22 cDNA Clone; NUDT22 cdna clone
Sequence
atggatcctgaggtgaccttgctgctgcagtgccctggcgggggcctgccccaggagcagatacaggccgagctgagccccgcccatgaccgtcgcccactgccaggtggggacgaggccatcactgccatctgggagacccggctaaaggcccaaccctggctcttcgacgcccccaagttccgcctgcactcagccaccctggcgcctattggctctcgggggccacagctgctcctgcgcctgggccttacttcctaccgagacttcctgggcaccaactggtccagctcagctgcctggctgcgacagcagggtgccaccgactggggtgacacgcaggcctatctggcggacccactgggggtgggcgctgcactagccacagccgatgacttccttgtcttcctgcgccgctcccggcaggtggctgaggcccctgggctggtggacgtacctggtgggcaccctgagcctcaggccctgtgccctggtggcagcccccagcaccaggacctcgctgggcagctggtggtacatgaactcttttccagtgtccttcaggagatctgtgatgaggtgaacctgccgctgctcaccctgagccagcccctgctgttgggcatcgcccgaaatgagaccagtgctggccgagccagtgccgagttctatgtccagtgcagcctgacttctgagcaggtgaggaagcactacctgagtgggggacccgaggcccacgagtctacaggaatcttctttgtggagacacagaacgtgcggagattgcccgagacggagatgtgggctgaactctgcccctcggccaaaggcgccatcatcctctacaaccgggttcagggaagtcccactggagcggccctagggtccccagccctactcccgccgctctga
Sequence Length
912
Vector
Please Inquire
NCBI and Uniprot Product Information
NCBI GI #
NCBI GeneID
Molecular Weight
29,077 Da
NCBI Official Full Name
Homo sapiens nudix (nucleoside diphosphate linked moiety X)-type motif 22, mRNA
NCBI Official Synonym Full Names
nudix hydrolase 22
NCBI Official Symbol
NUDT22
NCBI Protein Information
nucleoside diphosphate-linked moiety X motif 22
UniProt Protein Name
Nucleoside diphosphate-linked moiety X motif 22
Protein Family
UniProt Gene Name
NUDT22
UniProt Synonym Gene Names
Nudix motif 22
UniProt Entry Name
NUD22_HUMAN
Uniprot Description
NUDT22: Belongs to the Nudix hydrolase family. 2 isoforms of the human protein are produced by alternative splicing.
Chromosomal Location of Human Ortholog: 11q13.1
Cellular Component: nucleoplasm
Molecular Function: protein binding
Research Articles on NUDT22
Similar Products
Product Notes
The NUDT22 nudt22 (Catalog #AAA1277340) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggatcctg aggtgacctt gctgctgcag tgccctggcg ggggcctgcc ccaggagcag atacaggccg agctgagccc cgcccatgac cgtcgcccac tgccaggtgg ggacgaggcc atcactgcca tctgggagac ccggctaaag gcccaaccct ggctcttcga cgcccccaag ttccgcctgc actcagccac cctggcgcct attggctctc gggggccaca gctgctcctg cgcctgggcc ttacttccta ccgagacttc ctgggcacca actggtccag ctcagctgcc tggctgcgac agcagggtgc caccgactgg ggtgacacgc aggcctatct ggcggaccca ctgggggtgg gcgctgcact agccacagcc gatgacttcc ttgtcttcct gcgccgctcc cggcaggtgg ctgaggcccc tgggctggtg gacgtacctg gtgggcaccc tgagcctcag gccctgtgcc ctggtggcag cccccagcac caggacctcg ctgggcagct ggtggtacat gaactctttt ccagtgtcct tcaggagatc tgtgatgagg tgaacctgcc gctgctcacc ctgagccagc ccctgctgtt gggcatcgcc cgaaatgaga ccagtgctgg ccgagccagt gccgagttct atgtccagtg cagcctgact tctgagcagg tgaggaagca ctacctgagt gggggacccg aggcccacga gtctacagga atcttctttg tggagacaca gaacgtgcgg agattgcccg agacggagat gtgggctgaa ctctgcccct cggccaaagg cgccatcatc ctctacaacc gggttcaggg aagtcccact ggagcggccc tagggtcccc agccctactc ccgccgctct ga. It is sometimes possible for the material contained within the vial of "NUDT22, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.Precautions
All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.Disclaimer
Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.Item has been added to Shopping Cart
If you are ready to order, navigate to Shopping Cart and get ready to checkout.
