Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

NUDT21 cdna clone

NUDT21 cDNA Clone

Gene Names
NUDT21; CPSF5; CFIM25
Synonyms
NUDT21; NUDT21 cDNA Clone; NUDT21 cdna clone
Ordering
For Research Use Only!
Sequence
atgtctgtggtaccgcccaatcgctcgcagaccggctggccccggggggtcactcagttcggcaacaagtacatccagcagacgaagcccctcaccctggagcgcaccatcaacctgtaccctcttaccaattatacttttggtacaaaagagcccctctacgagaaggacagctctgttgcagccagatttcagcgcatgagggaagaatttgataaaattggaatgaggaggactgtagaaggggttctgattgtacatgagcaccggctaccccatgtgttactgctgcagctgggaacaactttcttcaaactacctggtggtgaacttaacccaggagaagatgaagttgaaggactaaaacgcttaatgacagagatactgggtcgtcaggatggagttttgcaagactgggtcattgacgattgcattggtaactggtggagaccaaattttgaacctcctcagtatccatatattcctgcacatattacaaagcctaaggaacataagaagttgtttctggttcagcttcaagaaaaagccttgtttgcagtccctaaaaattacaagctggtagctgcaccattgtttgaattgtatgacaatgcaccaggatatggacccatcatttctagtctccctcagctgttgagcaggttcaattttatttacaactga
Sequence Length
684
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
26,227 Da
NCBI Official Full Name
Homo sapiens nudix (nucleoside diphosphate linked moiety X)-type motif 21, mRNA
NCBI Official Synonym Full Names
nudix hydrolase 21
NCBI Official Symbol
NUDT21
NCBI Official Synonym Symbols
CPSF5; CFIM25
NCBI Protein Information
cleavage and polyadenylation specificity factor subunit 5
UniProt Protein Name
Cleavage and polyadenylation specificity factor subunit 5
Protein Family
UniProt Gene Name
NUDT21
UniProt Synonym Gene Names
CFIM25; CPSF25; CPSF5; CFIm25; CPSF 25 kDa subunit; Nudix motif 21
UniProt Entry Name
CPSF5_HUMAN

NCBI Description

The protein encoded by this gene is one subunit of a cleavage factor required for 3' RNA cleavage and polyadenylation processing. The interaction of the protein with the RNA is one of the earliest steps in the assembly of the 3' end processing complex and facilitates the recruitment of other processing factors. This gene encodes the 25kD subunit of the protein complex, which is composed of four polypeptides. [provided by RefSeq, Jul 2008]

Uniprot Description

CFIM25: Component of the cleavage factor Im (CFIm) complex that plays a key role in pre-mRNA 3'-processing. Involved in association with CPSF6 or CPSF7 in pre-MRNA 3'-end poly(A) site cleavage and poly(A) addition. NUDT21/CPSF5 binds to cleavage and polyadenylation RNA substrates. The homodimer mediates simultaneous sequence-specific recognition of two 5'-UGUA-3' elements within the pre-mRNA. Binds to, but does not hydrolyze mono- and di-adenosine nucleotides. May have a role in mRNA export. Belongs to the Nudix hydrolase family. CPSF5 subfamily.

Protein type: RNA-binding; RNA splicing; Spliceosome

Chromosomal Location of Human Ortholog: 16q12.2

Cellular Component: centrosome; microtubule organizing center; mRNA cleavage factor complex; nucleoplasm; nucleus; paraspeckles

Molecular Function: AU-rich element binding; histone deacetylase binding; mRNA binding; protein binding; protein homodimerization activity; RNA binding

Biological Process: mRNA 3'-end processing; mRNA polyadenylation; mRNA processing; nuclear mRNA splicing, via spliceosome; protein tetramerization; termination of RNA polymerase II transcription

Research Articles on NUDT21

Similar Products

Product Notes

The NUDT21 nudt21 (Catalog #AAA1268735) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgtctgtgg taccgcccaa tcgctcgcag accggctggc cccggggggt cactcagttc ggcaacaagt acatccagca gacgaagccc ctcaccctgg agcgcaccat caacctgtac cctcttacca attatacttt tggtacaaaa gagcccctct acgagaagga cagctctgtt gcagccagat ttcagcgcat gagggaagaa tttgataaaa ttggaatgag gaggactgta gaaggggttc tgattgtaca tgagcaccgg ctaccccatg tgttactgct gcagctggga acaactttct tcaaactacc tggtggtgaa cttaacccag gagaagatga agttgaagga ctaaaacgct taatgacaga gatactgggt cgtcaggatg gagttttgca agactgggtc attgacgatt gcattggtaa ctggtggaga ccaaattttg aacctcctca gtatccatat attcctgcac atattacaaa gcctaaggaa cataagaagt tgtttctggt tcagcttcaa gaaaaagcct tgtttgcagt ccctaaaaat tacaagctgg tagctgcacc attgtttgaa ttgtatgaca atgcaccagg atatggaccc atcatttcta gtctccctca gctgttgagc aggttcaatt ttatttacaa ctga. It is sometimes possible for the material contained within the vial of "NUDT21, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.