Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

NUDT18 cdna clone

NUDT18 cDNA Clone

Gene Names
NUDT18; MTH3
Synonyms
NUDT18; NUDT18 cDNA Clone; NUDT18 cdna clone
Ordering
For Research Use Only!
Sequence
atggcctcggagggcctggcgggggcgctggcttccgtgctggctggccaggggtccagcgtgcacagctgcgactcggcgccggccggggagccgccggcgcccgtgcggctgcggaagaacgtgtgctacgtggtgctggccgtgttcctcagcgagcaggatgaggtgctactgatccaggaggccaagagggagtgccgggggtcgtggtacctgcctgcggggagaatggagccaggggagaccatcgtggaggcgctgcagcgggaggtgaaggaggaggcggggctgcactgtgagcccgagacactgctgtccgtggaggagcggggcccctcctgggtccgcttcgtgttcctcgctcgccccacaggtggaattctcaagacttccaaggaggccgatgcggagtccctgcaggctgcctggtacccacggacctccctgcccactccgctgcgagcccatgacatcctgcacctggttgaactagccgcccagtatcgccagcaagccaggcaccctctcattctgccccaagagctaccctgtgatctggtctgccagcggctcgtggctacctttaccagcgcccagacagtgtgggtgttagtgggcacagtggggatgcctcacttgcctgtcactgcctgtggcctcgaccctatggagcagaggggtggcatgaagatggccgtcctgcggctgctgcaggagtgtctgaccctgcaccacttggtggtggagatcaaggggttgcttggactgcagcacctgggccgagatcacagtgatggcatctgtttgaatgtgctggtgaccgtggcttttcggagcccagggatccaggatgaacccccaaaagttcggggtgagaacttctcttggtggaaggtgatggaggaagacctgcaaagccagctcctccagcggcttcagggatcctctgttgtcccagtgaacagatag
Sequence Length
972
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
24,463 Da
NCBI Official Full Name
Homo sapiens nudix (nucleoside diphosphate linked moiety X)-type motif 18, mRNA
NCBI Official Synonym Full Names
nudix hydrolase 18
NCBI Official Symbol
NUDT18
NCBI Official Synonym Symbols
MTH3
NCBI Protein Information
8-oxo-dGDP phosphatase NUDT18
UniProt Protein Name
8-oxo-dGDP phosphatase NUDT18
Protein Family
UniProt Gene Name
NUDT18
UniProt Synonym Gene Names
MTH3; Nudix motif 18
UniProt Entry Name
NUD18_HUMAN

NCBI Description

The protein encoded by this gene is a member of the Nudix hydrolase family. Nudix hydrolases eliminate potentially toxic nucleotide metabolites from the cell and regulate the concentrations and availability of many different nucleotide substrates, cofactors, and signaling molecules. This protein contains a Nudix hydrolase domain and hydrolyzes oxidized forms of guanosine and deoxyguanosine diphosphates. [provided by RefSeq, Sep 2012]

Uniprot Description

NUDT18: Probably mediates the hydrolysis of some nucleoside diphosphate derivatives. Belongs to the Nudix hydrolase family. 2 isoforms of the human protein are produced by alternative splicing.

Protein type: EC 3.6.1.58; Hydrolase

Chromosomal Location of Human Ortholog: 8p21.3

Cellular Component: cytosol

Molecular Function: magnesium ion binding; protein binding

Biological Process: dADP catabolic process; dGDP catabolic process; GDP catabolic process

Research Articles on NUDT18

Similar Products

Product Notes

The NUDT18 nudt18 (Catalog #AAA1270270) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggcctcgg agggcctggc gggggcgctg gcttccgtgc tggctggcca ggggtccagc gtgcacagct gcgactcggc gccggccggg gagccgccgg cgcccgtgcg gctgcggaag aacgtgtgct acgtggtgct ggccgtgttc ctcagcgagc aggatgaggt gctactgatc caggaggcca agagggagtg ccgggggtcg tggtacctgc ctgcggggag aatggagcca ggggagacca tcgtggaggc gctgcagcgg gaggtgaagg aggaggcggg gctgcactgt gagcccgaga cactgctgtc cgtggaggag cggggcccct cctgggtccg cttcgtgttc ctcgctcgcc ccacaggtgg aattctcaag acttccaagg aggccgatgc ggagtccctg caggctgcct ggtacccacg gacctccctg cccactccgc tgcgagccca tgacatcctg cacctggttg aactagccgc ccagtatcgc cagcaagcca ggcaccctct cattctgccc caagagctac cctgtgatct ggtctgccag cggctcgtgg ctacctttac cagcgcccag acagtgtggg tgttagtggg cacagtgggg atgcctcact tgcctgtcac tgcctgtggc ctcgacccta tggagcagag gggtggcatg aagatggccg tcctgcggct gctgcaggag tgtctgaccc tgcaccactt ggtggtggag atcaaggggt tgcttggact gcagcacctg ggccgagatc acagtgatgg catctgtttg aatgtgctgg tgaccgtggc ttttcggagc ccagggatcc aggatgaacc cccaaaagtt cggggtgaga acttctcttg gtggaaggtg atggaggaag acctgcaaag ccagctcctc cagcggcttc agggatcctc tgttgtccca gtgaacagat ag. It is sometimes possible for the material contained within the vial of "NUDT18, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.