NUDT16L1 cdna clone
NUDT16L1 cDNA Clone
Gene Names
NUDT16L1; SDOS
Synonyms
NUDT16L1; NUDT16L1 cDNA Clone; NUDT16L1 cdna clone
Sequence
atgtcgacggcggcggttccggagctgaagcagatcagccgggtggaggcgatgcgcctagggccgggctggagccactcgtgccacgccatgctgtacgccgccaaccctgggcagctcttcggccgcatccccatgcgcttctcggtgctgatgcagatgcgtttcgacgggctgctgggcttccccgggggcttcgtggaccggcgcttctggtcgctggaggacggcctgaaccgggtgctgggcctgggcctgggctgcctgcgcctcaccgaggccgactacctgagctcgcacctgaccgagggcccacaccgcgtcgtggcgcacctgtacgcgcggcagctgacgctggagcagctgcacgccgtggagatcagcgcggtgcactcgcgcgaccacggcctggaggtgctgggcctcgtgcgggtcccgctgtacacccagaaggaccgagtcggaggcttccccaacttcctgagcaacgccttcgtgagcacggctaagtgccagctcctctttgccctcaaggtgctcaacatgatgcccgaggagaagctggttgaggccctggctgcagccaccgagaagcagaagaaggccctggagaagttgctcccggcctcctcttga
Sequence Length
636
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment
NCBI and Uniprot Product Information
NCBI GI #
NCBI GeneID
Molecular Weight
25,975 Da
NCBI Official Full Name
Homo sapiens nudix (nucleoside diphosphate linked moiety X)-type motif 16-like 1, mRNA
NCBI Official Synonym Full Names
nudix hydrolase 16 like 1
NCBI Official Symbol
NUDT16L1
NCBI Official Synonym Symbols
SDOS
NCBI Protein Information
protein syndesmos
UniProt Protein Name
Protein syndesmos
UniProt Gene Name
NUDT16L1
UniProt Synonym Gene Names
SDOS
UniProt Entry Name
SDOS_HUMAN
Uniprot Description
NUDT16L1: Probable adapter protein, which may link syndecan-4 (SDC4) and paxilin (TGFB1I1 and PXN) receptors. 2 isoforms of the human protein are produced by alternative splicing.
Protein type: Motility/polarity/chemotaxis
Chromosomal Location of Human Ortholog: 16p13.3
Molecular Function: m7G(5')pppN diphosphatase activity; protein binding; protein homodimerization activity; snoRNA binding
Similar Products
Product Notes
The NUDT16L1 nudt16l1 (Catalog #AAA1271828) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgtcgacgg cggcggttcc ggagctgaag cagatcagcc gggtggaggc gatgcgccta gggccgggct ggagccactc gtgccacgcc atgctgtacg ccgccaaccc tgggcagctc ttcggccgca tccccatgcg cttctcggtg ctgatgcaga tgcgtttcga cgggctgctg ggcttccccg ggggcttcgt ggaccggcgc ttctggtcgc tggaggacgg cctgaaccgg gtgctgggcc tgggcctggg ctgcctgcgc ctcaccgagg ccgactacct gagctcgcac ctgaccgagg gcccacaccg cgtcgtggcg cacctgtacg cgcggcagct gacgctggag cagctgcacg ccgtggagat cagcgcggtg cactcgcgcg accacggcct ggaggtgctg ggcctcgtgc gggtcccgct gtacacccag aaggaccgag tcggaggctt ccccaacttc ctgagcaacg ccttcgtgag cacggctaag tgccagctcc tctttgccct caaggtgctc aacatgatgc ccgaggagaa gctggttgag gccctggctg cagccaccga gaagcagaag aaggccctgg agaagttgct cccggcctcc tcttga. It is sometimes possible for the material contained within the vial of "NUDT16L1, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.Precautions
All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.Disclaimer
Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.Item has been added to Shopping Cart
If you are ready to order, navigate to Shopping Cart and get ready to checkout.
