NUBP2 cdna clone
NUBP2 cDNA Clone
Gene Names
NUBP2; CFD1; NBP 2; NUBP1
Synonyms
NUBP2; NUBP2 cDNA Clone; NUBP2 cdna clone
Sequence
atggaggcggcggccgagcctggaaacctggccggcgtcaggcacatcatcctggtcctctcaggaaaggggggcgttgggaaaagcaccatctccacggagctggccctggcactgcgccatgcaggcaagaaggtgggaatcctggatgtggacctgtgtggccccagtataccccgcatgctcggggcgcagggcagggctgtgcaccagtgcgaccgcggctgggcacccgtcttcctggaccgggagcagagcatctcgctcatgtctgtgggcttcctgctggagaagccggacgaggccgtggtgtggagaggccccaagaaaaacgcgctgataaagcagtttgtgtccgacgtggcctggggggagctggactacctggtggtggacacgcccccggggacctccgatgagcacatggccaccatagaagccctgcgtccctaccagcccctgggggccctcgtggtcaccacgccccaggcggtgtccgtgggggacgtgaggcgcgagctgaccttctgtaggaagacgggcttgcgggtgatgggaatcgtggagaatatgagcggcttcacctgcccacactgcacggagtgcaccagcgtcttctccaggggcggcggagaggagctggcccagctcgccggggtgcccttcttaggctccgtgcccctggaccctgcgctcatgaggaccctggaggagggccacgacttcatccaggagttccccgggagccccgccttcgctgcactcacctccatagcccagaagattctggacgcgacgcccgcgtgcctcccctga
Sequence Length
816
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment
NCBI and Uniprot Product Information
NCBI GI #
NCBI GeneID
Molecular Weight
28,825 Da
NCBI Official Full Name
Homo sapiens nucleotide binding protein 2 (MinD homolog, E. coli), mRNA
NCBI Official Synonym Full Names
nucleotide binding protein 2
NCBI Official Symbol
NUBP2
NCBI Official Synonym Symbols
CFD1; NBP 2; NUBP1
NCBI Protein Information
cytosolic Fe-S cluster assembly factor NUBP2
UniProt Protein Name
Cytosolic Fe-S cluster assembly factor NUBP2
Protein Family
UniProt Gene Name
NUBP2
UniProt Synonym Gene Names
NBP 2
UniProt Entry Name
NUBP2_HUMAN
NCBI Description
This gene encodes an adenosine triphosphate (ATP) and metal-binding protein that is required for the assembly of cyotosolic iron-sulfur proteins. The encoded protein functions in a heterotetramer with nucleotide-binding protein 1 (NUBP1). Alternative splicing results in multiple transcript variants. [provided by RefSeq, Oct 2013]
Uniprot Description
NUBP2: Component of the cytosolic iron-sulfur (Fe/S) protein assembly machinery. Required for maturation of extramitochondrial Fe/S proteins. May bind and transfer a labile 4Fe-4S cluster to target apoproteins. Belongs to the Mrp/NBP35 ATP-binding proteins family. NUBP2/CFD1 subfamily.
Chromosomal Location of Human Ortholog: 16p13.3
Molecular Function: nucleotide binding; protein binding
Research Articles on NUBP2
1. Observational study of gene-disease association and gene-environment interaction. (HuGE Navigator)
Similar Products
Product Notes
The NUBP2 nubp2 (Catalog #AAA1277800) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggaggcgg cggccgagcc tggaaacctg gccggcgtca ggcacatcat cctggtcctc tcaggaaagg ggggcgttgg gaaaagcacc atctccacgg agctggccct ggcactgcgc catgcaggca agaaggtggg aatcctggat gtggacctgt gtggccccag tataccccgc atgctcgggg cgcagggcag ggctgtgcac cagtgcgacc gcggctgggc acccgtcttc ctggaccggg agcagagcat ctcgctcatg tctgtgggct tcctgctgga gaagccggac gaggccgtgg tgtggagagg ccccaagaaa aacgcgctga taaagcagtt tgtgtccgac gtggcctggg gggagctgga ctacctggtg gtggacacgc ccccggggac ctccgatgag cacatggcca ccatagaagc cctgcgtccc taccagcccc tgggggccct cgtggtcacc acgccccagg cggtgtccgt gggggacgtg aggcgcgagc tgaccttctg taggaagacg ggcttgcggg tgatgggaat cgtggagaat atgagcggct tcacctgccc acactgcacg gagtgcacca gcgtcttctc caggggcggc ggagaggagc tggcccagct cgccggggtg cccttcttag gctccgtgcc cctggaccct gcgctcatga ggaccctgga ggagggccac gacttcatcc aggagttccc cgggagcccc gccttcgctg cactcacctc catagcccag aagattctgg acgcgacgcc cgcgtgcctc ccctga. It is sometimes possible for the material contained within the vial of "NUBP2, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.Precautions
All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.Disclaimer
Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.Item has been added to Shopping Cart
If you are ready to order, navigate to Shopping Cart and get ready to checkout.
