Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

NTRK3 cdna clone

NTRK3 cDNA Clone

Gene Names
NTRK3; TRKC; GP145-TrkC; gp145(trkC)
Synonyms
NTRK3; NTRK3 cDNA Clone; NTRK3 cdna clone
Ordering
For Research Use Only!
Sequence
atggatgtctctctttgcccagccaagtgtagtttctggcggattttcttgctgggaagcgtctggctggactatgtgggctccgtgctggcttgccctgcaaattgtgtctgcagcaagactgagatcaattgccggcggccggacgatgggaacctcttccccctcctggaagggcaggattcagggaacagcaatgggaacgccagtatcaacatcacggacatctcaaggaatatcacttccatacacatagagaactggcgcagtcttcacacgctcaacgccgtggacatggagctctacaccggacttcaaaagctgaccatcaagaactcaggacttcggagcattcagcccagagcctttgccaagaacccccatttgcgttatataaacctgtcaagtaaccggctcaccacactctcgtggcagctcttccagacgctgagtcttcgggaattgcagttggagcagaactttttcaactgcagctgtgacatccgctggatgcagctctggcaggagcagggggaggccaagctcaacagccagaacctctactgcatcaacgctgatggctcccagcttcctctcttccgcatgaacatcagtcagtgtgaccttcctgagatcagcgtgagccacgtcaacctgaccgtacgagagggtgacaatgctgttatcacttgcaatggctctggatcaccccttcctgatgtggactggatagtcactgggctgcagtccatcaacactcaccagaccaatctgaactggaccaatgttcatgccatcaacttgacgctggtgaatgtgacgagtgaggacaatggcttcaccctgacgtgcattgcagagaacgtggtgggcatgagcaatgccagtgttgccctcactgtctactatcccccacgtgtggtgagcctggaggagcctgagctgcgcctggagcactgcatcgagtttgtggtgcgtggcaaccccccaccaacgctgcactggctgcacaatgggcagcctctgcgggagtccaagatcatccatgtggaatactaccaagagggagagatttccgagggctgcctgctcttcaacaagcccacccactacaacaatggcaactataccctcattgccaaaaacccactgggcacagccaaccagaccatcaatggccacttcctcaaggagccctttccagagagcacggataactttatcttgtttgacgaagtgagtcccacacctcctatcactgtgacccacaaaccagaagaagacacttttggggtatccatagcagttggacttgctgcttttgcctgtgtcctgttggtggttctcttcgtcatgatcaacaaatatggtcgacggtccaaatttggaatgaagggtcccgtggctgtcatcagtggtgaggaggactcagccagcccactgcaccacatcaaccacggcatcaccacgccctcgtcactggatgcggggcccgacactgtggtcattggcatgactcgcatccctgtcattgagaacccccagtacttccgtcagggacacaactgccacaagccggacacgtgggtcttttcaaacatagacaatcatgggatattaaacttgaaggacaatagagatcatctagtcccatcaactcactatatatatgaggaacctgaggtccagagtggggaagtgtcttacccaaggtcacatggtttcagagaaattatgttgaatccaataagccttcccggacattccaagcctcttaaccatggcatctatgttgaggatgtcaatgtttatttcagcaaaggacgtcatggcttttaa
Sequence Length
1839
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
91,833 Da
NCBI Official Full Name
Homo sapiens neurotrophic tyrosine kinase, receptor, type 3, mRNA
NCBI Official Synonym Full Names
neurotrophic receptor tyrosine kinase 3
NCBI Official Symbol
NTRK3
NCBI Official Synonym Symbols
TRKC; GP145-TrkC; gp145(trkC)
NCBI Protein Information
NT-3 growth factor receptor
UniProt Protein Name
NT-3 growth factor receptor
UniProt Gene Name
NTRK3
UniProt Synonym Gene Names
TRKC; Trk-C
UniProt Entry Name
NTRK3_HUMAN

NCBI Description

This gene encodes a member of the neurotrophic tyrosine receptor kinase (NTRK) family. This kinase is a membrane-bound receptor that, upon neurotrophin binding, phosphorylates itself and members of the MAPK pathway. Signalling through this kinase leads to cell differentiation and may play a role in the development of proprioceptive neurons that sense body position. Mutations in this gene have been associated with medulloblastomas, secretory breast carcinomas and other cancers. Several transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2011]

Uniprot Description

TrkC: a receptor tyrosine kinase of the TRK family. Receptor for neurotrophin-3 (NT-3). Known substrates for the trk receptors are SHC, PI-3 kinase, and PLCG1. Four alternatively spliced isoforms are known.

Protein type: Membrane protein, integral; Protein kinase, tyrosine (receptor); Protein kinase, TK; Kinase, protein; EC 2.7.10.1; TK group; Trk family

Chromosomal Location of Human Ortholog: 15q25

Cellular Component: receptor complex

Molecular Function: neurotrophin binding; neurotrophin receptor activity; p53 binding; protein binding

Biological Process: activation of MAPK activity; activation of protein kinase B; heart development; negative regulation of protein amino acid phosphorylation; positive regulation of cell migration; positive regulation of cell proliferation; positive regulation of peptidyl-serine phosphorylation; positive regulation of positive chemotaxis; positive regulation of protein amino acid phosphorylation; transmembrane receptor protein tyrosine kinase signaling pathway

Research Articles on NTRK3

Similar Products

Product Notes

The NTRK3 ntrk3 (Catalog #AAA1268505) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggatgtct ctctttgccc agccaagtgt agtttctggc ggattttctt gctgggaagc gtctggctgg actatgtggg ctccgtgctg gcttgccctg caaattgtgt ctgcagcaag actgagatca attgccggcg gccggacgat gggaacctct tccccctcct ggaagggcag gattcaggga acagcaatgg gaacgccagt atcaacatca cggacatctc aaggaatatc acttccatac acatagagaa ctggcgcagt cttcacacgc tcaacgccgt ggacatggag ctctacaccg gacttcaaaa gctgaccatc aagaactcag gacttcggag cattcagccc agagcctttg ccaagaaccc ccatttgcgt tatataaacc tgtcaagtaa ccggctcacc acactctcgt ggcagctctt ccagacgctg agtcttcggg aattgcagtt ggagcagaac tttttcaact gcagctgtga catccgctgg atgcagctct ggcaggagca gggggaggcc aagctcaaca gccagaacct ctactgcatc aacgctgatg gctcccagct tcctctcttc cgcatgaaca tcagtcagtg tgaccttcct gagatcagcg tgagccacgt caacctgacc gtacgagagg gtgacaatgc tgttatcact tgcaatggct ctggatcacc ccttcctgat gtggactgga tagtcactgg gctgcagtcc atcaacactc accagaccaa tctgaactgg accaatgttc atgccatcaa cttgacgctg gtgaatgtga cgagtgagga caatggcttc accctgacgt gcattgcaga gaacgtggtg ggcatgagca atgccagtgt tgccctcact gtctactatc ccccacgtgt ggtgagcctg gaggagcctg agctgcgcct ggagcactgc atcgagtttg tggtgcgtgg caacccccca ccaacgctgc actggctgca caatgggcag cctctgcggg agtccaagat catccatgtg gaatactacc aagagggaga gatttccgag ggctgcctgc tcttcaacaa gcccacccac tacaacaatg gcaactatac cctcattgcc aaaaacccac tgggcacagc caaccagacc atcaatggcc acttcctcaa ggagcccttt ccagagagca cggataactt tatcttgttt gacgaagtga gtcccacacc tcctatcact gtgacccaca aaccagaaga agacactttt ggggtatcca tagcagttgg acttgctgct tttgcctgtg tcctgttggt ggttctcttc gtcatgatca acaaatatgg tcgacggtcc aaatttggaa tgaagggtcc cgtggctgtc atcagtggtg aggaggactc agccagccca ctgcaccaca tcaaccacgg catcaccacg ccctcgtcac tggatgcggg gcccgacact gtggtcattg gcatgactcg catccctgtc attgagaacc cccagtactt ccgtcaggga cacaactgcc acaagccgga cacgtgggtc ttttcaaaca tagacaatca tgggatatta aacttgaagg acaatagaga tcatctagtc ccatcaactc actatatata tgaggaacct gaggtccaga gtggggaagt gtcttaccca aggtcacatg gtttcagaga aattatgttg aatccaataa gccttcccgg acattccaag cctcttaacc atggcatcta tgttgaggat gtcaatgttt atttcagcaa aggacgtcat ggcttttaa. It is sometimes possible for the material contained within the vial of "NTRK3, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.