Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

NRM cdna clone

NRM cDNA Clone

Gene Names
NRM; NRM29
Synonyms
NRM; NRM cDNA Clone; NRM cdna clone
Ordering
For Research Use Only!
Sequence
atggcccctgcactgctcctgatccctgctgccctcgcctctttcatcctggcctttggcaccggagtggagttcgtgcgctttacctcccttcggccacttcttggagggatcccggagtctggtggtccggatgcccgccagggatggctggctgccctgcaggaccgcagcatccttgcccccctggcatgggatctggggctcctgcttctatttgttgggcagcacagcctcatggcagctgaaagagtgaaggcatggacatcccggtactttggggtccttcagaggtcactgtatgtggcctgcactgccctggccttgcagctggtgatgcggtactgggagcccatacccaaaggccctgtgttgtgggaggctcgggctgagccatgggccacctgggtgccgctcctctgctttgtgctccatgtcatctcctggctcctcatctttagcatccttctcgtctttgactatgctgagctcatgggcctcaaacaggtatactaccatgtgctggggctgggcgagcctctggccctgaagtctccccgggctctcagactcttctcccacctgcgccacccagtgtgtgtggagctgctgacagtgctgtgggtggtgcctaccctgggcacggaccgtctcctccttgctttcctccttaccctctacctgggcctggctcacgggcttgatcagcaagacctccgctacctccgggcccagctacaaagaaaactccacctgctctctcggccccaggatggggaggcagagtga
Sequence Length
789
Vector
pENTR223.1
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
10,526 Da
NCBI Official Full Name
Homo sapiens nurim (nuclear envelope membrane protein), mRNA
NCBI Official Synonym Full Names
nurim (nuclear envelope membrane protein)
NCBI Official Symbol
NRM
NCBI Official Synonym Symbols
NRM29
NCBI Protein Information
nurim
UniProt Protein Name
Nurim
Protein Family
UniProt Gene Name
NRM
UniProt Synonym Gene Names
NRM29
UniProt Entry Name
NRM_HUMAN

NCBI Description

The protein encoded by this gene contains transmembrane domains and resides within the inner nuclear membrane, where it is tightly associated with the nucleus. This protein shares homology with isoprenylcysteine carboxymethyltransferase enzymes. Alternative splicing results in multiple transcript variants that encode different protein isoforms. [provided by RefSeq, Jul 2012]

Uniprot Description

NRM: contains transmembrane domains and resides within the inner nuclear membrane, where it is tightly associated with the nucleus. This protein shares homology with isoprenylcysteine carboxymethyltransferase enzymes. Alternative splicing results in multiple transcript variants that encode different protein isoforms. [provided by RefSeq, Jul 2012]

Protein type: Membrane protein, integral; Membrane protein, multi-pass

Chromosomal Location of Human Ortholog: 6p21.33

Cellular Component: membrane; nuclear envelope

Molecular Function: protein binding

Research Articles on NRM

Similar Products

Product Notes

The NRM nrm (Catalog #AAA1269562) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggcccctg cactgctcct gatccctgct gccctcgcct ctttcatcct ggcctttggc accggagtgg agttcgtgcg ctttacctcc cttcggccac ttcttggagg gatcccggag tctggtggtc cggatgcccg ccagggatgg ctggctgccc tgcaggaccg cagcatcctt gcccccctgg catgggatct ggggctcctg cttctatttg ttgggcagca cagcctcatg gcagctgaaa gagtgaaggc atggacatcc cggtactttg gggtccttca gaggtcactg tatgtggcct gcactgccct ggccttgcag ctggtgatgc ggtactggga gcccataccc aaaggccctg tgttgtggga ggctcgggct gagccatggg ccacctgggt gccgctcctc tgctttgtgc tccatgtcat ctcctggctc ctcatcttta gcatccttct cgtctttgac tatgctgagc tcatgggcct caaacaggta tactaccatg tgctggggct gggcgagcct ctggccctga agtctccccg ggctctcaga ctcttctccc acctgcgcca cccagtgtgt gtggagctgc tgacagtgct gtgggtggtg cctaccctgg gcacggaccg tctcctcctt gctttcctcc ttaccctcta cctgggcctg gctcacgggc ttgatcagca agacctccgc tacctccggg cccagctaca aagaaaactc cacctgctct ctcggcccca ggatggggag gcagagtga. It is sometimes possible for the material contained within the vial of "NRM, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.