Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

NRG4 cdna clone

NRG4 cDNA Clone

Gene Names
NRG4; HRG4
Synonyms
NRG4; NRG4 cDNA Clone; NRG4 cdna clone
Ordering
For Research Use Only!
Sequence
atgccaacagatcacgaagagccctgtggtcccagtcacaagtcgttttgcctgaatggggggctttgttatgtgatacctactattcccagcccattttgtaggtgcgttgaaaactatacaggagctcgttgtgaagaggtttttctcccaggctccagcatccaaactaaaagtaacctgtttgaagcttttgtggcattggcggtcctagtaacacttatcattggagccttctacttcctttgcaggaaaggccactttcagagagccagttcagtccagtatgatatcaacctggtagagacgagcagtaccagtgcccaccacagtcatgaacaacactga
Sequence Length
348
Vector
pENTR223.1
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
12,722 Da
NCBI Official Full Name
Homo sapiens neuregulin 4, mRNA
NCBI Official Synonym Full Names
neuregulin 4
NCBI Official Symbol
NRG4
NCBI Official Synonym Symbols
HRG4
NCBI Protein Information
pro-neuregulin-4, membrane-bound isoform
UniProt Protein Name
Pro-neuregulin-4, membrane-bound isoform
Protein Family
UniProt Gene Name
NRG4
UniProt Synonym Gene Names
Pro-NRG4; NRG-4
UniProt Entry Name
NRG4_HUMAN

NCBI Description

The neuregulins, including NRG4, activate type-1 growth factor receptors (see EGFR; MIM 131550) to initiating cell-to-cell signaling through tyrosine phosphorylation (Harari et al., 1999 [PubMed 10348342]).[supplied by OMIM, Mar 2008]

Uniprot Description

NRG4: Low affinity ligand for the ERBB4 tyrosine kinase receptor. Concomitantly recruits ERBB1 and ERBB2 coreceptors, resulting in ligand-stimulated tyrosine phosphorylation and activation of the ERBB receptors. Does not bind to the ERBB1, ERBB2 and ERBB3 receptors. Belongs to the neuregulin family.

Protein type: Membrane protein, integral

Chromosomal Location of Human Ortholog: 15q24.2

Cellular Component: extracellular region; extracellular space

Molecular Function: phosphatidylinositol-4,5-bisphosphate 3-kinase activity; protein binding; protein-tyrosine kinase activity; Ras guanyl-nucleotide exchange factor activity; receptor binding

Biological Process: MAPKKK cascade; organ development; phosphoinositide-mediated signaling; regulation of phosphoinositide 3-kinase cascade

Research Articles on NRG4

Similar Products

Product Notes

The NRG4 nrg4 (Catalog #AAA1277135) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgccaacag atcacgaaga gccctgtggt cccagtcaca agtcgttttg cctgaatggg gggctttgtt atgtgatacc tactattccc agcccatttt gtaggtgcgt tgaaaactat acaggagctc gttgtgaaga ggtttttctc ccaggctcca gcatccaaac taaaagtaac ctgtttgaag cttttgtggc attggcggtc ctagtaacac ttatcattgg agccttctac ttcctttgca ggaaaggcca ctttcagaga gccagttcag tccagtatga tatcaacctg gtagagacga gcagtaccag tgcccaccac agtcatgaac aacactga. It is sometimes possible for the material contained within the vial of "NRG4, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.