NRBP1 cdna clone
NRBP1 cDNA Clone
Gene Names
NRBP1; MADM; NRBP; BCON3; MUDPNP
Synonyms
NRBP1; NRBP1 cDNA Clone; NRBP1 cdna clone
Sequence
atgtcggagggggagtcccagacagtacttagcagtggctcagacccaaaggtagaatcctcatcttcagctcctggcctgacatcagtgtcacctcctgtgacctccacaacctcagctgcttccccagaggaagaagaagaaagtgaagatgagtctgagattttggaagagtcgccctgtgggcgctggcagaagaggcgagaagaggtgaatcaacggaatgtaccaggtattgacagtgcatacctggccatggatacagaggaaggtgtagaggttgtgtggaatgaggtacagttctctgaacgcaagaactacaagctgcaggaggaaaaggttcgtgctgtgtttgataatctgattcaattggagcatcttaacattgttaagtttcacaaatattgggctgacattaaagagaacaaggccagggtcatttttatcacagaatacatgtcatctgggagtctgaagcaatttctgaagaagaccaaaaagaaccacaagacgatgaatgaaaaggcatggaagcgttggtgcacacaaatcctctctgccctaagctacctgcactcctgtgacccccccatcatccatgggaacctgacctgtgacaccatcttcatccagcacaacggactcatcaagattggctctgtggctcctgacactatcaacaatcatgtgaagacttgtcgagaagagcagaagaatctacacttctttgcaccagagtatggagaagtcactaatgtgacaacagcagtggacatctactcctttggcatgtgtgcactggagatggcagtgctggagattcagggcaatggagagtcctcatatgtgccacaggaagccatcagcagtgccatccagcttctagaagacccattacagagggagttcattcaaaagtgcctgcagtctgagcctgctcgcagaccaacagccagagaacttctgttccacccagcattgtttgaagtgccctcgctcaaactccttgcggcccactgcattgtgggacaccaacacatgatcccagagaacgctctagaggagatcaccaaaaacatggatactagtgccgtactggctgaaatccctgcaggaccaggaagagaaccagttcagactttgtactctcagtcaccagctctggaattagataaattccttgaagatgtcaggaatgggatctatcctctgacagcctttgggctgcctcggccccagcagccacagcaggaggaggtgacatcacctgtcgtgcccccctctgtcaagactccgacacctgaaccagctgaggtggagactcgcaaggtggtgctgatgcagtgcaacattgagtcggtggaggagggagtcaaacaccacctgacacttctgctgaagttggaggacaaactgaaccggcacctgagctgtgacctgatgccaaatgagaatatccccgagttggcggctgagctggtgcagctgggcttcattagtgaggctgaccagagccggttgacttctctgctagaagagaccttgaacaagttcaattttgccaggaacagtaccctcaactcagccgctgtcaccgtctcctcttag
Sequence Length
1608
Vector
pENTR223.1
Clone Sequence Report
Provided with product shipment
NCBI and Uniprot Product Information
NCBI GI #
NCBI GeneID
Molecular Weight
59,845 Da
NCBI Official Full Name
Homo sapiens nuclear receptor binding protein 1, mRNA
NCBI Official Synonym Full Names
nuclear receptor binding protein 1
NCBI Official Symbol
NRBP1
NCBI Official Synonym Symbols
MADM; NRBP; BCON3; MUDPNP
NCBI Protein Information
nuclear receptor-binding protein
UniProt Protein Name
Nuclear receptor-binding protein
Protein Family
UniProt Gene Name
NRBP1
UniProt Entry Name
NRBP_HUMAN
Uniprot Description
NRBP1: May play a role in subcellular trafficking between the endoplasmic reticulum and Golgi apparatus through interactions with the Rho-type GTPases. Binding to the NS3 protein of dengue virus type 2 appears to subvert this activity into the alteration of the intracellular membrane structure associated with flaviviral replication. Belongs to the protein kinase superfamily. Ser/Thr protein kinase family.
Protein type: Protein kinase, Other; Kinase, protein; Protein kinase, Ser/Thr (non-receptor); Other group; NRBP family
Chromosomal Location of Human Ortholog: 2p23
Cellular Component: cytosol; endomembrane system; nucleoplasm
Molecular Function: protein binding; protein homodimerization activity; protein serine/threonine kinase activity
Biological Process: ER to Golgi vesicle-mediated transport; protein amino acid phosphorylation; transcription initiation from RNA polymerase II promoter
Research Articles on NRBP1
Similar Products
Product Notes
The NRBP1 nrbp1 (Catalog #AAA1265971) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgtcggagg gggagtccca gacagtactt agcagtggct cagacccaaa ggtagaatcc tcatcttcag ctcctggcct gacatcagtg tcacctcctg tgacctccac aacctcagct gcttccccag aggaagaaga agaaagtgaa gatgagtctg agattttgga agagtcgccc tgtgggcgct ggcagaagag gcgagaagag gtgaatcaac ggaatgtacc aggtattgac agtgcatacc tggccatgga tacagaggaa ggtgtagagg ttgtgtggaa tgaggtacag ttctctgaac gcaagaacta caagctgcag gaggaaaagg ttcgtgctgt gtttgataat ctgattcaat tggagcatct taacattgtt aagtttcaca aatattgggc tgacattaaa gagaacaagg ccagggtcat ttttatcaca gaatacatgt catctgggag tctgaagcaa tttctgaaga agaccaaaaa gaaccacaag acgatgaatg aaaaggcatg gaagcgttgg tgcacacaaa tcctctctgc cctaagctac ctgcactcct gtgacccccc catcatccat gggaacctga cctgtgacac catcttcatc cagcacaacg gactcatcaa gattggctct gtggctcctg acactatcaa caatcatgtg aagacttgtc gagaagagca gaagaatcta cacttctttg caccagagta tggagaagtc actaatgtga caacagcagt ggacatctac tcctttggca tgtgtgcact ggagatggca gtgctggaga ttcagggcaa tggagagtcc tcatatgtgc cacaggaagc catcagcagt gccatccagc ttctagaaga cccattacag agggagttca ttcaaaagtg cctgcagtct gagcctgctc gcagaccaac agccagagaa cttctgttcc acccagcatt gtttgaagtg ccctcgctca aactccttgc ggcccactgc attgtgggac accaacacat gatcccagag aacgctctag aggagatcac caaaaacatg gatactagtg ccgtactggc tgaaatccct gcaggaccag gaagagaacc agttcagact ttgtactctc agtcaccagc tctggaatta gataaattcc ttgaagatgt caggaatggg atctatcctc tgacagcctt tgggctgcct cggccccagc agccacagca ggaggaggtg acatcacctg tcgtgccccc ctctgtcaag actccgacac ctgaaccagc tgaggtggag actcgcaagg tggtgctgat gcagtgcaac attgagtcgg tggaggaggg agtcaaacac cacctgacac ttctgctgaa gttggaggac aaactgaacc ggcacctgag ctgtgacctg atgccaaatg agaatatccc cgagttggcg gctgagctgg tgcagctggg cttcattagt gaggctgacc agagccggtt gacttctctg ctagaagaga ccttgaacaa gttcaatttt gccaggaaca gtaccctcaa ctcagccgct gtcaccgtct cctcttag. It is sometimes possible for the material contained within the vial of "NRBP1, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.Precautions
All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.Disclaimer
Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.Item has been added to Shopping Cart
If you are ready to order, navigate to Shopping Cart and get ready to checkout.
