Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

NR4A1 cdna clone

NR4A1 cDNA Clone

Gene Names
NR4A1; HMR; N10; TR3; NP10; GFRP1; NAK-1; NGFIB; NUR77
Synonyms
NR4A1; NR4A1 cDNA Clone; NR4A1 cdna clone
Ordering
For Research Use Only!
Sequence
atgccctgtatccaagcccaatatgggacaccagcaccgagtccgggaccccgtgaccacctggcaagcgaccccctgacccctgagttcatcaagcccaccatggacctggccagccccgaggcagcccccgctgcccccactgccctgcccagcttcagcaccttcatggacggctacacaggagagtttgacaccttcctctaccagctgccaggaacagtccagccatgctcctcagcctcctcctcggcctcctccacatcctcgtcctcagccacctcccctgcctctgcctccttcaagttcgaggacttccaggtgtacggctgctaccccggccccctgagcggcccagtggatgaggccctgtcctccagtggctctgactactatggcagcccctgctcggccccgtcgccctccacgcccagcttccagccgccccagctctctccctgggatggctccttcggccacttctcgcccagccagacttacgaaggcctgcgggcatggacagagcagctgcccaaagcctctgggcccccacagcctccagccttcttttccttcagtcctcccaccggccccagccccagcctggcccagagccccctgaagttgttcccctcacaggccacccaccagctgggggagggagagagctattccatgcctacggccttcccaggtttggcacccacttctccacaccttgagggctcggggatactggatacacccgtgacctcaaccaaggcccggagcggggccccaggtggaagtgaaggccgctgtgctgtgtgtggggacaacgcttcatgccagcattatggtgtccgcacatgtgagggctgcaagggcttcttcaagcgcacagtgcagaaaaacgccaagtacatctgcctggctaacaaggactgccctgtggacaagaggcggcgaaaccgctgccagttctgccgcttccagaagtgcctggcggtgggcatggtgaaggaagttgtccgaacagacagcctgaaggggcggcggggccggctaccttcaaaacccaagcagcccccagatgcctcccctgccaatctcctcacttccctggtccgtgcacacctggactcagggcccagcactgccaaactggactactccaagttccaggagctggtgctgccccactttgggaaggaagatgctggggatgtacagcagttctacgacctgctctccggttctctggaggtcatccgcaagtgggcggagaagatccctggctttgctgagctgtcaccggctgaccaggacctgttgctggagtcggccttcctggagctcttcatcctccgcctggcgtacaggtctaagccaggcgagggcaagctcatcttctgctcaggcctggtgctacaccggctgcagtgtgcccgtggcttcggggactggattgacagtatcctggccttctcaaggtccctgcacagcttgcttgtcgatgtccctgccttcgcctgcctctctgcccttgtcctcatcaccgaccggcatgggctgcaggagccgcggcgggtggaggagctgcagaaccgcatcgccagctgcctgaaggagcacgtggcagctgtggcgggcgagccccagccagccagctgcctgtcacgtctgttgggcaaactgcccgagctgcggaccctgtgcacccagggcctgcagcgcatcttctacctcaagctggaggacttggtgccccctccacccatcattgacaagatcttcatggacacgctgcccttctga
Sequence Length
1797
Vector
Please Inquire

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
33,754 Da
NCBI Official Full Name
Homo sapiens nuclear receptor subfamily 4, group A, member 1, mRNA
NCBI Official Synonym Full Names
nuclear receptor subfamily 4 group A member 1
NCBI Official Symbol
NR4A1
NCBI Official Synonym Symbols
HMR; N10; TR3; NP10; GFRP1; NAK-1; NGFIB; NUR77
NCBI Protein Information
nuclear receptor subfamily 4 group A member 1
UniProt Protein Name
Nuclear receptor subfamily 4 group A member 1
UniProt Gene Name
NR4A1
UniProt Synonym Gene Names
GFRP1; HMR; NAK1; Nur77
UniProt Entry Name
NR4A1_HUMAN

NCBI Description

This gene encodes a member of the steroid-thyroid hormone-retinoid receptor superfamily. Expression is induced by phytohemagglutinin in human lymphocytes and by serum stimulation of arrested fibroblasts. The encoded protein acts as a nuclear transcription factor. Translocation of the protein from the nucleus to mitochondria induces apoptosis. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jan 2011]

Uniprot Description

Nur77: an orphan nuclear receptor and immediate-early gene that regulates cellular proliferation, apoptosis, inflammation, and glucose metabolism. Induced by exercise in muscle and is a functional regulator of glucose metabolism in skeletal muscle. Its level decreases in the muscle of obese insulin-resistant men. Acts concomitantly with NURR1 in regulating the expression of delayed-early genes during liver regeneration. Binds the NGFI-B response element (NBRE) 5'-AAAAGGTCA-3'. May inhibit NF-kappa-B transactivation of IL2. A mediator of TCR-directed thymocyte apoptosis. TCR-signaling induces a FAIM/Akt/Nur77 signaling pathway that is critical for modulating apoptosis in developing thymocytes. A physiological substrate of the MEK-ERK-RSK cascade that modulates nuclear export and intracellular translocation during T cell death. Binds DNA as a monomer. Interacts with GADD45GIP1. Overexpression of Nur77 induces the expression of both p300 and HDAC1. Acetylation by p300 and HDAC1 may regulate the rapid turnover of Nur77 protein.

Protein type: Apoptosis; Nuclear receptor; DNA-binding

Chromosomal Location of Human Ortholog: 12q13

Cellular Component: cytoplasm; nuclear membrane; nucleoplasm; nucleus

Molecular Function: DNA binding; protein binding; protein heterodimerization activity

Biological Process: cell migration during sprouting angiogenesis; fat cell differentiation; negative regulation of cell cycle; positive regulation of endothelial cell proliferation; positive regulation of transcription from RNA polymerase II promoter; signal transduction; transcription initiation from RNA polymerase II promoter

Research Articles on NR4A1

Similar Products

Product Notes

The NR4A1 nr4a1 (Catalog #AAA1267148) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgccctgta tccaagccca atatgggaca ccagcaccga gtccgggacc ccgtgaccac ctggcaagcg accccctgac ccctgagttc atcaagccca ccatggacct ggccagcccc gaggcagccc ccgctgcccc cactgccctg cccagcttca gcaccttcat ggacggctac acaggagagt ttgacacctt cctctaccag ctgccaggaa cagtccagcc atgctcctca gcctcctcct cggcctcctc cacatcctcg tcctcagcca cctcccctgc ctctgcctcc ttcaagttcg aggacttcca ggtgtacggc tgctaccccg gccccctgag cggcccagtg gatgaggccc tgtcctccag tggctctgac tactatggca gcccctgctc ggccccgtcg ccctccacgc ccagcttcca gccgccccag ctctctccct gggatggctc cttcggccac ttctcgccca gccagactta cgaaggcctg cgggcatgga cagagcagct gcccaaagcc tctgggcccc cacagcctcc agccttcttt tccttcagtc ctcccaccgg ccccagcccc agcctggccc agagccccct gaagttgttc ccctcacagg ccacccacca gctgggggag ggagagagct attccatgcc tacggccttc ccaggtttgg cacccacttc tccacacctt gagggctcgg ggatactgga tacacccgtg acctcaacca aggcccggag cggggcccca ggtggaagtg aaggccgctg tgctgtgtgt ggggacaacg cttcatgcca gcattatggt gtccgcacat gtgagggctg caagggcttc ttcaagcgca cagtgcagaa aaacgccaag tacatctgcc tggctaacaa ggactgccct gtggacaaga ggcggcgaaa ccgctgccag ttctgccgct tccagaagtg cctggcggtg ggcatggtga aggaagttgt ccgaacagac agcctgaagg ggcggcgggg ccggctacct tcaaaaccca agcagccccc agatgcctcc cctgccaatc tcctcacttc cctggtccgt gcacacctgg actcagggcc cagcactgcc aaactggact actccaagtt ccaggagctg gtgctgcccc actttgggaa ggaagatgct ggggatgtac agcagttcta cgacctgctc tccggttctc tggaggtcat ccgcaagtgg gcggagaaga tccctggctt tgctgagctg tcaccggctg accaggacct gttgctggag tcggccttcc tggagctctt catcctccgc ctggcgtaca ggtctaagcc aggcgagggc aagctcatct tctgctcagg cctggtgcta caccggctgc agtgtgcccg tggcttcggg gactggattg acagtatcct ggccttctca aggtccctgc acagcttgct tgtcgatgtc cctgccttcg cctgcctctc tgcccttgtc ctcatcaccg accggcatgg gctgcaggag ccgcggcggg tggaggagct gcagaaccgc atcgccagct gcctgaagga gcacgtggca gctgtggcgg gcgagcccca gccagccagc tgcctgtcac gtctgttggg caaactgccc gagctgcgga ccctgtgcac ccagggcctg cagcgcatct tctacctcaa gctggaggac ttggtgcccc ctccacccat cattgacaag atcttcatgg acacgctgcc cttctga. It is sometimes possible for the material contained within the vial of "NR4A1, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.