Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

NR2C1 cdna clone

NR2C1 cDNA Clone

Gene Names
NR2C1; TR2
Synonyms
NR2C1; NR2C1 cDNA Clone; NR2C1 cdna clone
Ordering
For Research Use Only!
Sequence
atggcaaccatagaagaaattgcacatcaaattattgaacaacagatgggagagattgttacagagcagcaaactgggcagaaaatccagattgtgacagcacttgatcataatacccaaggcaagcagttcattctgacaaatcacgacggctctactccaagcaaagtcattctggccaggcaagattccactccgggaaaagttttccttacaactccagatgcagcaggtgtcaaccagttattttttaccactcctgatctgtctgcacaacacctgcagctcctaacagataattctccagaccaaggaccaaataaggtttttgatctttgcgtagtatgtggagacaaagcatcaggacgtcattatggagcagtaacttgtgaaggctgcaaaggattttttaaaagaagcatccgaaaaaatttagtatattcatgtcgaggatcaaaggattgtattattaataagcaccaccgaaaccgctgtcaatactgcaggttacagagatgtattgcgtttggaatgaagcaagactctgtccaatgtgaaagaaaacccattgaagtatcacgagaaaaatcttccaactgtgccgcttcaacagaaaaaatctatatccgaaaggaccttcgtagcccattaactgcaactccaacttttgtaacagatagtgaaagtacaaggtcaacaggactgttagattcaggaatgttcatgaatattcatccatctggagtaaaaactgagtcagctgtgctgatgacatcagataaggctgaatcatgtcagggagatttaagtacattggccaatgtggttacatcattagcgaatcttggaaaaactaaagatctttctcaaaatagtaatgaaatgtctatgattgaaagcttaagcaatgatgatacctctttgtgtgaatttcaagaaatgcagaccaacggtgatgtttcaagggcatttgacactcttgcaaaagcattgaatcctggagagagcacagcctgccagagctcagtagcgggcatggaaggaagtgtacacctaatcactggagattcaagcataaattacaccgaaaaagaggggccacttctcagcgattcacatgtagctttcaggctcaccatgccttctcctatgcctgagtacctgaatgtgcactacattggggagtctgcctccagactgctgttcttatcaatgcactgggcactttcgattccttctttccaggctctagggcaagaaaacagcatatcactggtgaaagcttactggaatgaactttttactcttggtcttgcccagtgctggcaagtgatgaatgtagcaactatattagcaacatttgtcaattgtcttcacaatagtcttcaacaagcagaggggtaa
Sequence Length
1404
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
53,042 Da
NCBI Official Full Name
Homo sapiens nuclear receptor subfamily 2, group C, member 1, mRNA
NCBI Official Synonym Full Names
nuclear receptor subfamily 2 group C member 1
NCBI Official Symbol
NR2C1
NCBI Official Synonym Symbols
TR2
NCBI Protein Information
nuclear receptor subfamily 2 group C member 1
UniProt Protein Name
Nuclear receptor subfamily 2 group C member 1
UniProt Gene Name
NR2C1
UniProt Synonym Gene Names
TR2
UniProt Entry Name
NR2C1_HUMAN

NCBI Description

This gene encodes a nuclear hormone receptor characterized by a highly conserved DNA binding domain (DBD), a variable hinge region, and a carboxy-terminal ligand binding domain (LBD) that is typical for all members of the steroid/thyroid hormone receptor superfamily. This protein also belongs to a large family of ligand-inducible transcription factors that regulate gene expression by binding to specific DNA sequences within promoters of target genes. Multiple alternatively spliced transcript variants have been described, but the full-length nature of some of these variants has not been determined. [provided by RefSeq, Jul 2008]

Uniprot Description

NR2C1: Orphan nuclear receptor. Binds the IR7 element in the promoter of its own gene in an autoregulatory negative feedback mechanism. Primarily repressor of a broad range of genes. Binds to hormone response elements (HREs) consisting of two 5'-AGGTCA-3' half site direct repeat consensus sequences. Together with NR2C2, forms the core of the DRED (direct repeat erythroid-definitive) complex that represses embryonic and fetal globin transcription. Also activator of OCT4 gene expression. May be involved in stem cell proliferation and differentiation. Mediator of retinoic acid- regulated preadipocyte proliferation. Belongs to the nuclear hormone receptor family. NR2 subfamily. 3 isoforms of the human protein are produced by alternative splicing.

Protein type: DNA-binding; Nuclear receptor

Chromosomal Location of Human Ortholog: 12q22

Cellular Component: nucleoplasm

Molecular Function: DNA binding; protein binding; receptor activity

Biological Process: transcription initiation from RNA polymerase II promoter

Research Articles on NR2C1

Similar Products

Product Notes

The NR2C1 nr2c1 (Catalog #AAA1269520) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggcaacca tagaagaaat tgcacatcaa attattgaac aacagatggg agagattgtt acagagcagc aaactgggca gaaaatccag attgtgacag cacttgatca taatacccaa ggcaagcagt tcattctgac aaatcacgac ggctctactc caagcaaagt cattctggcc aggcaagatt ccactccggg aaaagttttc cttacaactc cagatgcagc aggtgtcaac cagttatttt ttaccactcc tgatctgtct gcacaacacc tgcagctcct aacagataat tctccagacc aaggaccaaa taaggttttt gatctttgcg tagtatgtgg agacaaagca tcaggacgtc attatggagc agtaacttgt gaaggctgca aaggattttt taaaagaagc atccgaaaaa atttagtata ttcatgtcga ggatcaaagg attgtattat taataagcac caccgaaacc gctgtcaata ctgcaggtta cagagatgta ttgcgtttgg aatgaagcaa gactctgtcc aatgtgaaag aaaacccatt gaagtatcac gagaaaaatc ttccaactgt gccgcttcaa cagaaaaaat ctatatccga aaggaccttc gtagcccatt aactgcaact ccaacttttg taacagatag tgaaagtaca aggtcaacag gactgttaga ttcaggaatg ttcatgaata ttcatccatc tggagtaaaa actgagtcag ctgtgctgat gacatcagat aaggctgaat catgtcaggg agatttaagt acattggcca atgtggttac atcattagcg aatcttggaa aaactaaaga tctttctcaa aatagtaatg aaatgtctat gattgaaagc ttaagcaatg atgatacctc tttgtgtgaa tttcaagaaa tgcagaccaa cggtgatgtt tcaagggcat ttgacactct tgcaaaagca ttgaatcctg gagagagcac agcctgccag agctcagtag cgggcatgga aggaagtgta cacctaatca ctggagattc aagcataaat tacaccgaaa aagaggggcc acttctcagc gattcacatg tagctttcag gctcaccatg ccttctccta tgcctgagta cctgaatgtg cactacattg gggagtctgc ctccagactg ctgttcttat caatgcactg ggcactttcg attccttctt tccaggctct agggcaagaa aacagcatat cactggtgaa agcttactgg aatgaacttt ttactcttgg tcttgcccag tgctggcaag tgatgaatgt agcaactata ttagcaacat ttgtcaattg tcttcacaat agtcttcaac aagcagaggg gtaa. It is sometimes possible for the material contained within the vial of "NR2C1, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.