Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

NOX4 cdna clone

NOX4 cDNA Clone

Gene Names
NOX4; KOX; KOX-1; RENOX
Synonyms
NOX4; NOX4 cDNA Clone; NOX4 cdna clone
Ordering
For Research Use Only!
Sequence
atggctgtgtcctggaggagctggctcgccaacgaaggggttaaacacctctgcctgttcatctggctctccatgaatgtcctgcttttctggaaaaccttcttgctgtataaccaagggccagagtatcactacctccaccagatgttggggctaggattgtgtctaagcagagcctcagcatctgttcttaacctcaactgcagccttatccttttacccatgtgccgaacactcttggcttacctccgaggatcacagaaggttccaagcaggagaaccaggagattgttggataaaagcagaacattccatattacctgtggtgttactatctgtattttctcaggcgtgcatgtggctgcccatctggtgaatgccctcaacttctcagtgaattacagtgaagactttgttgaactgaatgcagcaagataccgagatgaggatcctagaaaacttctcttcacaactgttcctggcctgacaggggtctgcatggtggtggtgctattcctcatgatcacagcctctacatatgcaataagagtttctaactatgatatcttctggtatactcataacctcttctttgtcttctacatgctgctgacgttgcatgtttcaggagggctgctgaagtatcaaactaatttagatacccaccctcccggctgcatcagtcttaaccgaaccagctctcagaatatttccttaccagagtatttctcagaacattttcatgaacctttccctgaaggattttcaaaaccggcagagtttacccagcacaaatttgtgaagatttgtatggaagagcccagattccaagctaattttccacagacttggctttggatttctggacctttgtgcctgtactgtgccgaaagactttacaggtatatccggagcaataagccagtcaccatcatttcggtcataagtcatccctcagatgtcatggaaatccgaatggtcaaagaaaattttaaagcaagacctggtcagtatattactctacattgtcccagtgtatctgcattagaaaatcatccatttaccctcacaatgtgtccaactgaaaccaaagcaacatttggggttcatcttaaaatagtaggagactggacagaacgatttcgagatttactactgcctccatctagtcaagactccgaaattctgcccttcattcaatctagaaattatcccaagctgtatattgatggtccttttggaagtccatttgaggaatcactgaactatgaggtcagcctctgcgtggctggaggcattggagtaactccatttgcatcaatactcaacaccctgttggatgactggaaaccatacaagcttagaagactatactttatttgggtatgcagagatatccagtccttccgttggtttgcagatttactctgtatgttgcataacaagttttggcaagagaacagacctgactatgtcaacatccagctgtacctcagtcaaacagatgggatacagaagataattggagaaaaatatcatgcactgaattcaagactgtttataggacgtcctcggtggaaacttttgtttgatgaaatagcaaaatataacagaggaaaaacagttggtgttttctgttgtggacccaattcactatccaagactcttcataaactgagtaaccagaacaactcatatgggacaagatttgaatacaataaagagtctttcagctga
Sequence Length
1737
Vector
pENTR223.1
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
59,915 Da
NCBI Official Full Name
Homo sapiens NADPH oxidase 4, mRNA
NCBI Official Synonym Full Names
NADPH oxidase 4
NCBI Official Symbol
NOX4
NCBI Official Synonym Symbols
KOX; KOX-1; RENOX
NCBI Protein Information
NADPH oxidase 4
UniProt Protein Name
NADPH oxidase 4
Protein Family
UniProt Gene Name
NOX4
UniProt Synonym Gene Names
RENOX; KOX-1
UniProt Entry Name
NOX4_HUMAN

NCBI Description

This gene encodes a member of the NOX-family of enzymes that functions as the catalytic subunit the NADPH oxidase complex. The encoded protein is localized to non-phagocytic cells where it acts as an oxygen sensor and catalyzes the reduction of molecular oxygen to various reactive oxygen species (ROS). The ROS generated by this protein have been implicated in numerous biological functions including signal transduction, cell differentiation and tumor cell growth. A pseudogene has been identified on the other arm of chromosome 11. Alternative splicing results in multiple transcript variants.[provided by RefSeq, Jan 2009]

Uniprot Description

NOX4: Constitutive NADPH oxidase which generates superoxide intracellularly upon formation of a complex with CYBA/p22phox. Regulates signaling cascades probably through phosphatases inhibition. May function as an oxygen sensor regulating the KCNK3/TASK-1 potassium channel and HIF1A activity. May regulate insulin signaling cascade. May play a role in apoptosis, bone resorption and lipolysaccharide-mediated activation of NFKB. May produce superoxide in the nucleus and play a role in regulating gene expression upon cell stimulation. Isoform 3 is not functional. Isoform 4 displays an increased activity. Isoform 5 and isoform 6 display reduced activity. 7 isoforms of the human protein are produced by alternative splicing.

Protein type: Oxidoreductase; Nucleolus; Membrane protein, multi-pass; Cell cycle regulation; Membrane protein, integral; EC 1.6.3.-

Chromosomal Location of Human Ortholog: 11q14.2-q21

Cellular Component: endoplasmic reticulum membrane; integral to membrane

Molecular Function: electron carrier activity; FAD binding; heme binding; NAD(P)H oxidase activity; nucleotide binding; oxygen sensor activity; protein binding; superoxide-generating NADPH oxidase activity

Biological Process: cell aging; cell morphogenesis; gene expression; homocysteine metabolic process; inflammatory response; negative regulation of cell proliferation; response to reactive oxygen species; superoxide metabolic process; superoxide release

Research Articles on NOX4

Similar Products

Product Notes

The NOX4 nox4 (Catalog #AAA1269330) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggctgtgt cctggaggag ctggctcgcc aacgaagggg ttaaacacct ctgcctgttc atctggctct ccatgaatgt cctgcttttc tggaaaacct tcttgctgta taaccaaggg ccagagtatc actacctcca ccagatgttg gggctaggat tgtgtctaag cagagcctca gcatctgttc ttaacctcaa ctgcagcctt atccttttac ccatgtgccg aacactcttg gcttacctcc gaggatcaca gaaggttcca agcaggagaa ccaggagatt gttggataaa agcagaacat tccatattac ctgtggtgtt actatctgta ttttctcagg cgtgcatgtg gctgcccatc tggtgaatgc cctcaacttc tcagtgaatt acagtgaaga ctttgttgaa ctgaatgcag caagataccg agatgaggat cctagaaaac ttctcttcac aactgttcct ggcctgacag gggtctgcat ggtggtggtg ctattcctca tgatcacagc ctctacatat gcaataagag tttctaacta tgatatcttc tggtatactc ataacctctt ctttgtcttc tacatgctgc tgacgttgca tgtttcagga gggctgctga agtatcaaac taatttagat acccaccctc ccggctgcat cagtcttaac cgaaccagct ctcagaatat ttccttacca gagtatttct cagaacattt tcatgaacct ttccctgaag gattttcaaa accggcagag tttacccagc acaaatttgt gaagatttgt atggaagagc ccagattcca agctaatttt ccacagactt ggctttggat ttctggacct ttgtgcctgt actgtgccga aagactttac aggtatatcc ggagcaataa gccagtcacc atcatttcgg tcataagtca tccctcagat gtcatggaaa tccgaatggt caaagaaaat tttaaagcaa gacctggtca gtatattact ctacattgtc ccagtgtatc tgcattagaa aatcatccat ttaccctcac aatgtgtcca actgaaacca aagcaacatt tggggttcat cttaaaatag taggagactg gacagaacga tttcgagatt tactactgcc tccatctagt caagactccg aaattctgcc cttcattcaa tctagaaatt atcccaagct gtatattgat ggtccttttg gaagtccatt tgaggaatca ctgaactatg aggtcagcct ctgcgtggct ggaggcattg gagtaactcc atttgcatca atactcaaca ccctgttgga tgactggaaa ccatacaagc ttagaagact atactttatt tgggtatgca gagatatcca gtccttccgt tggtttgcag atttactctg tatgttgcat aacaagtttt ggcaagagaa cagacctgac tatgtcaaca tccagctgta cctcagtcaa acagatggga tacagaagat aattggagaa aaatatcatg cactgaattc aagactgttt ataggacgtc ctcggtggaa acttttgttt gatgaaatag caaaatataa cagaggaaaa acagttggtg ttttctgttg tggacccaat tcactatcca agactcttca taaactgagt aaccagaaca actcatatgg gacaagattt gaatacaata aagagtcttt cagctga. It is sometimes possible for the material contained within the vial of "NOX4, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.