Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

NINJ2 cdna clone

NINJ2 cDNA Clone

Synonyms
NINJ2; NINJ2 cDNA Clone; NINJ2 cdna clone
Ordering
For Research Use Only!
Sequence
atggaatcagcaagagaaaacatcgaccttcaacctggaagctccgaccccaggagccagcccatcaacctgaaccattacgccaccaagaagagcgtggcggagagcatgctggacgtggccctgttcatgtccaacgccatgcggctgaaggcggtgctggagcagggaccatcctctcactactacaccaccctggtcaccctcatcagcctctctctgctcctgcaggtggtcatcggtgtcctgctcgtggtcattgcacggctgaacctgaatgaggtagaaaagcagtggcgactcaaccagctcaacaacgcagccaccatcttggtcttcttcactgtggtcatcaatgttttcattacagccttcggggcacataaaacagggttcctggctgcaagggcctcaaggaatcctctctga
Sequence Length
429
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
15,680 Da
NCBI Official Full Name
Homo sapiens ninjurin 2, mRNA
NCBI Official Synonym Full Names
ninjurin 2
NCBI Official Symbol
NINJ2
NCBI Protein Information
ninjurin-2
UniProt Protein Name
Ninjurin-2
Protein Family
UniProt Gene Name
NINJ2
UniProt Entry Name
NINJ2_HUMAN

NCBI Description

The protein encoded by this gene belongs to the ninjurin (for nerve injury induced) family. It is a cell surface adhesion protein that is upregulated in Schwann cells surrounding the distal segment of injured nerve, and promotes neurite outgrowth, thus may have a role in nerve regeneration after nerve injury. [provided by RefSeq, Oct 2011]

Uniprot Description

NINJ2: Homophilic cell adhesion molecule that promotes axonal growth. May play a role in nerve regeneration and in the formation and function of other tissues. Belongs to the ninjurin family.

Protein type: Cell adhesion; Motility/polarity/chemotaxis; Membrane protein, multi-pass; Cell development/differentiation; Membrane protein, integral

Chromosomal Location of Human Ortholog: 12p13

Cellular Component: integral to plasma membrane

Molecular Function: protein binding

Biological Process: nervous system development; neuron adhesion

Research Articles on NINJ2

Similar Products

Product Notes

The NINJ2 ninj2 (Catalog #AAA1266640) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggaatcag caagagaaaa catcgacctt caacctggaa gctccgaccc caggagccag cccatcaacc tgaaccatta cgccaccaag aagagcgtgg cggagagcat gctggacgtg gccctgttca tgtccaacgc catgcggctg aaggcggtgc tggagcaggg accatcctct cactactaca ccaccctggt caccctcatc agcctctctc tgctcctgca ggtggtcatc ggtgtcctgc tcgtggtcat tgcacggctg aacctgaatg aggtagaaaa gcagtggcga ctcaaccagc tcaacaacgc agccaccatc ttggtcttct tcactgtggt catcaatgtt ttcattacag ccttcggggc acataaaaca gggttcctgg ctgcaagggc ctcaaggaat cctctctga. It is sometimes possible for the material contained within the vial of "NINJ2, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.