NICN1 cdna clone
NICN1 cDNA Clone
Synonyms
NICN1; NICN1 cDNA Clone; NICN1 cdna clone
Sequence
atgtcccgcgttttggtgccttgccatgtgaaaggctccgtagccctccaggtgggcgacgtgcggacctcccaaggccggcctggcgtgctggtcatcgatgtcaccttccccagcgtcgctcccttcgagttgcaggaaatcacgtttaagaattactacacagcttttttgagcatccgtgtccgtcagtacacctcagcacacacacctgccaagtgggtgacctgcctgcgggactactgcctaatgcctgacccacacagtgaggagggagcccaggagtatgtatcgctgttcaagcatcagatgctgtgtgacatggctagaatatcggagctacgcctgattctgcggcagccatcaccactgtggctgtctttcacagtggaggagctgcagatctatcagcagggaccaaagagcccctccgtgacctttcccaagtggctctcccacccagtgccctgtgagcaacctgcactcctccgtgagggtctcccagaccccagcagggtatcctccgaggtgcagcagatgtgggcactgacagagatgatccgggccagtcacacctccgcaaggatcggccgctttgatgtggatggctgttatgacctgaacttgctctcctacacttga
Sequence Length
642
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment
NCBI and Uniprot Product Information
NCBI GI #
NCBI GeneID
Molecular Weight
19,506 Da
NCBI Official Full Name
Homo sapiens nicolin 1, mRNA
NCBI Official Synonym Full Names
nicolin 1
NCBI Official Symbol
NICN1
NCBI Protein Information
nicolin-1
UniProt Protein Name
Nicolin-1
Protein Family
UniProt Gene Name
NICN1
UniProt Synonym Gene Names
PGs5
UniProt Entry Name
NICN1_HUMAN
NCBI Description
This protein encoded by this gene localizes to the nucleus and is expressed in numerous tissues including brain, testis, liver, and kidney. This refseq contains genomic sequence in its 3' UTR which is not supported by experimental evidence. Computer predictions indicate that this region of the 3' UTR contains hairpin-forming self-complementary sequence which is possibly excised after transcription. This gene has a pseudogene on chromosome X. [provided by RefSeq, Jul 2008]
Uniprot Description
NICN1: 2 isoforms of the human protein are produced by alternative splicing.
Protein type: Cytoskeletal
Chromosomal Location of Human Ortholog: 3p21.31
Research Articles on NICN1
1. results provide important clues to elucidate the regulation of NPCEDRG gene expression and function
Similar Products
Product Notes
The NICN1 nicn1 (Catalog #AAA1266166) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgtcccgcg ttttggtgcc ttgccatgtg aaaggctccg tagccctcca ggtgggcgac gtgcggacct cccaaggccg gcctggcgtg ctggtcatcg atgtcacctt ccccagcgtc gctcccttcg agttgcagga aatcacgttt aagaattact acacagcttt tttgagcatc cgtgtccgtc agtacacctc agcacacaca cctgccaagt gggtgacctg cctgcgggac tactgcctaa tgcctgaccc acacagtgag gagggagccc aggagtatgt atcgctgttc aagcatcaga tgctgtgtga catggctaga atatcggagc tacgcctgat tctgcggcag ccatcaccac tgtggctgtc tttcacagtg gaggagctgc agatctatca gcagggacca aagagcccct ccgtgacctt tcccaagtgg ctctcccacc cagtgccctg tgagcaacct gcactcctcc gtgagggtct cccagacccc agcagggtat cctccgaggt gcagcagatg tgggcactga cagagatgat ccgggccagt cacacctccg caaggatcgg ccgctttgat gtggatggct gttatgacct gaacttgctc tcctacactt ga. It is sometimes possible for the material contained within the vial of "NICN1, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.Precautions
All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.Disclaimer
Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.Item has been added to Shopping Cart
If you are ready to order, navigate to Shopping Cart and get ready to checkout.
