Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

NHLH2 cdna clone

NHLH2

Synonyms
NHLH2; bHLHa34; HEN2; NSCL2; NHLH2 cdna clone
Ordering
For Research Use Only!
Form/Format
Lyophilized
Sequence
Nucleotide Sequence: ATGATGCTGAGTCCGGACCAAGCAGCAGATTCGGACCATCCCAGCTCGGCGCACTCGGATCCGGAGTCCCTGGGCGGCACGGACACCAAGGTGCTCGGCAGCGTGTCGGACCTGGAGCCGGTGGAGGAGGCCGAGGGCGACGGCAAGGGCGGCAGCCGAGCCGCGCTCTACCCGCACCCGCAGCAGCTGAGCCGCGAGGAGAAGCGCCGCCGCCGGCGCGCCACGGCCAAGTACCGCTCGGCCCACGCCACCCGCGAGCGCATCCGCGTGGAAGCCTTCAACTTGGCCTTCGCCGAGCTCCGCAAATTGCTGCCCACGCTGCCCCCGGACAAGAAGCTCTCCAAGATCGAGATCCTGCGCCTGGCCATCTGCTACATCTCCTATCTCAACCACGTCCTGGACGTGTAG

Translation Sequence: MMLSPDQAAD SDHPSSAHSD PESLGGTDTK VLGSVSDLEP VEEAEGDGKG GSRAALYPHPQQLSREEKRR RRRATAKYRS AHATRERIRV EAFNLAFAEL RKLLPTLPPD KKLSKIEILRLAICYISYLN HVLDV
Sequence Length
135
Species
Human
Chromosome Location
1p12-p11
OMIM Reference Number
162361
cDNA Size
408bp
Vector Description
This shuttle vector contains the complete ORF. It is inseted Nde I to Xho I. The gene insert contains multiple cloning sites which can be used to easily cut and transfer the gene and recombination site into your expression vector.
Vector
(puc19-derived cloning vector)
Preparation Before Usage
1. Centrifuge at 7000rpm for 1 minute. 2. Carefully open the vial and add 100ul of sterile water to dissolve the DNA. Each tube contains approximately 10ug of lyophilized plasmid.
Preparation and Storage
Store the plasmid at -20 degree C.
Related Product Information for NHLH2 cdna clone
NHLH2 (Nescient Helix Loop Helix 2) serve as DNA-binding protein and may be involved in the control of cell-type determination, possibly within the developing nervous system.
Product Categories/Family for NHLH2 cdna clone

NCBI and Uniprot Product Information

NCBI GI #
NCBI Accession #
NCBI GenBank Nucleotide #
UniProt Accession #
NCBI Official Full Name
helix-loop-helix protein 2
UniProt Protein Name
Helix-loop-helix protein 2
Protein Family
UniProt Gene Name
NHLH2
UniProt Synonym Gene Names
BHLHA34; HEN2; KIAA0490; HEN-2; bHLHa34; NSCL-2
UniProt Entry Name
HEN2_HUMAN

Uniprot Description

NHLH2: May serve as DNA-binding protein and may be involved in the control of cell-type determination, possibly within the developing nervous system.

Chromosomal Location of Human Ortholog: 1p12-p11

Cellular Component: transcription factor complex; nucleus

Molecular Function: protein dimerization activity; protein binding; DNA binding

Biological Process: central nervous system development; ovulation cycle; transcription, DNA-dependent; mating behavior; positive regulation of transcription from RNA polymerase II promoter; positive regulation of transcription factor activity; cell differentiation

Similar Products

Product Notes

The NHLH2 nhlh2 (Catalog #AAA200994) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: Nucleotide Sequence: ATGATGCTGA GTCCGGACCA AGCAGCAGAT TCGGACCATC CCAGCTCGGC GCACTCGGAT CCGGAGTCCC TGGGCGGCAC GGACACCAAG GTGCTCGGCA GCGTGTCGGA CCTGGAGCCG GTGGAGGAGG CCGAGGGCGA CGGCAAGGGC GGCAGCCGAG CCGCGCTCTA CCCGCACCCG CAGCAGCTGA GCCGCGAGGA GAAGCGCCGC CGCCGGCGCG CCACGGCCAA GTACCGCTCG GCCCACGCCA CCCGCGAGCG CATCCGCGTG GAAGCCTTCA ACTTGGCCTT CGCCGAGCTC CGCAAATTGC TGCCCACGCT GCCCCCGGAC AAGAAGCTCT CCAAGATCGA GATCCTGCGC CTGGCCATCT GCTACATCTC CTATCTCAAC CACGTCCTGG ACGTGTAG Tran slation Sequence: MMLSPDQAAD SDHPSSAHSD PESLGGTDTK VLGSVSDLEP VEEAEGDGKG GSRAALYPHP QQLSREEKRR RRRATAKYRS AHATRERIRV EAFNLAFAEL RKLLPTLPPD KKLSKIEILR LAICYISYLN HVLDV. It is sometimes possible for the material contained within the vial of "NHLH2, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.