Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

NFKBIB cdna clone

NFKBIB cDNA Clone

Gene Names
NFKBIB; IKBB; TRIP9
Synonyms
NFKBIB; NFKBIB cDNA Clone; NFKBIB cdna clone
Ordering
For Research Use Only!
Sequence
atggctggggtcgcgtgcttgggaaaagctgccgacgcagatgaatggtgcgacagcggcctgggctccctgggtccggacgcagcggcccccggaggacctgggttgggcgcggagttgggcccggggctgtcgtgggctcccctcgtcttcggctacgtcactgaggatggggacacggcactgcacttggctgtgattcatcagcatgaacccttcctggattttcttctaggcttctcggccggcactgagtacatggacctgcagaatgacctaggccagacagccctgcacctggcagccatcctgggggagacatccacggtggagaagctgtacgcagcaggcgccgggctgtgtgtggcggagcgtaggggccacacggcgctgcacctggcctgccgtgtgggggcacacgcctgtgcccgtgccctgcttcagccccgcccccggcgccccagggaagcccccgacacctacctcgctcagggccctgaccgtactcccgacaccaaccatacccctgtcgccttgtaccccgattccgacttggagaaggaagaagaggagagtgaggaggactggaagctgcagctggaggctgaaaactacgagggccacaccccactccacgtggccgttatccacaaagatgtggagatggtccggctgctccgagatgctggagctgaccttgacaaaccggagcccacgtgcggccggagcccccttcatttggcagtggaggcccaggcagccgatgtgctggagcttctcctgagggcaggcgcgaaccctgctgcccgcatgtacggtggccgcaccccactcggcagtgccatgctccggcccaaccccatcctcgcccgcctcctccgtgcacacggagcccctgagcccgagggcgaggacgagaaatccggcccctgcagcagcagtagcgacagcgacagcggagacgagggcgatgaatacgacgacattgtggttcacagcagccgcagccaaacccggctgcctcccaccccagcctcaaaacctcttcctgacgacccccgccccgtgtga
Sequence Length
1071
Vector
Please Inquire

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
35,530 Da
NCBI Official Full Name
Homo sapiens nuclear factor of kappa light polypeptide gene enhancer in B-cells inhibitor, beta, mRNA
NCBI Official Synonym Full Names
NFKB inhibitor beta
NCBI Official Symbol
NFKBIB
NCBI Official Synonym Symbols
IKBB; TRIP9
NCBI Protein Information
NF-kappa-B inhibitor beta
UniProt Protein Name
NF-kappa-B inhibitor beta
Protein Family
UniProt Gene Name
NFKBIB
UniProt Synonym Gene Names
IKBB; TRIP9; NF-kappa-BIB; IkB-B; IkB-beta; IkappaBbeta; TR-interacting protein 9; TRIP-9
UniProt Entry Name
IKBB_HUMAN

NCBI Description

The protein encoded by this gene belongs to the NF-kappa-B inhibitor family, which inhibit NF-kappa-B by complexing with, and trapping it in the cytoplasm. Phosphorylation of serine residues on these proteins by kinases marks them for destruction via the ubiquitination pathway, thereby allowing activation of the NF-kappa-B, which translocates to the nucleus to function as a transcription factor. Alternatively spliced transcript variants have been found for this gene.[provided by RefSeq, Jul 2011]

Uniprot Description

IkB-beta: a protein of the NF-kappa-B inhibitor family. Inhibits NF-kappa-B by complexing with and trapping it in the cytoplasm. However, the unphosphorylated form resynthesized after cell stimulation is able to bind NF-kappa-B allowing its transport to the nucleus and protecting it to further IKBA- dependent inactivation. Association with inhibitor kappa B- interacting Ras-like proteins 1 and 2 may also explain the slower degradation. Interacts with ligand-binding domain of thyroid hormone receptor-beta, inhibitor kappa B-interacting Ras-like protein 1, inhibitor kappa B-interacting protein Ras2, p65 (RELA) and c-Rel. Expressed in all tissues examined.

Protein type: Inhibitor

Chromosomal Location of Human Ortholog: 19q13.1

Cellular Component: cytosol

Molecular Function: protein binding; signal transducer activity; transcription coactivator activity

Biological Process: activation of NF-kappaB transcription factor; transcription, DNA-dependent

Research Articles on NFKBIB

Similar Products

Product Notes

The NFKBIB nfkbib (Catalog #AAA1276048) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggctgggg tcgcgtgctt gggaaaagct gccgacgcag atgaatggtg cgacagcggc ctgggctccc tgggtccgga cgcagcggcc cccggaggac ctgggttggg cgcggagttg ggcccggggc tgtcgtgggc tcccctcgtc ttcggctacg tcactgagga tggggacacg gcactgcact tggctgtgat tcatcagcat gaacccttcc tggattttct tctaggcttc tcggccggca ctgagtacat ggacctgcag aatgacctag gccagacagc cctgcacctg gcagccatcc tgggggagac atccacggtg gagaagctgt acgcagcagg cgccgggctg tgtgtggcgg agcgtagggg ccacacggcg ctgcacctgg cctgccgtgt gggggcacac gcctgtgccc gtgccctgct tcagccccgc ccccggcgcc ccagggaagc ccccgacacc tacctcgctc agggccctga ccgtactccc gacaccaacc atacccctgt cgccttgtac cccgattccg acttggagaa ggaagaagag gagagtgagg aggactggaa gctgcagctg gaggctgaaa actacgaggg ccacacccca ctccacgtgg ccgttatcca caaagatgtg gagatggtcc ggctgctccg agatgctgga gctgaccttg acaaaccgga gcccacgtgc ggccggagcc cccttcattt ggcagtggag gcccaggcag ccgatgtgct ggagcttctc ctgagggcag gcgcgaaccc tgctgcccgc atgtacggtg gccgcacccc actcggcagt gccatgctcc ggcccaaccc catcctcgcc cgcctcctcc gtgcacacgg agcccctgag cccgagggcg aggacgagaa atccggcccc tgcagcagca gtagcgacag cgacagcgga gacgagggcg atgaatacga cgacattgtg gttcacagca gccgcagcca aacccggctg cctcccaccc cagcctcaaa acctcttcct gacgaccccc gccccgtgtg a. It is sometimes possible for the material contained within the vial of "NFKBIB, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.