NFKBIA cdna clone

NFKBIA cDNA Clone

Cat. Num. AAA1274487

• Gene Names: NFKBIA; IKBA; MAD-3; NFKBI
• Synonyms: NFKBIA; NFKBIA cDNA Clone; NFKBIA cdna clone

• Sequence: atgttccaggcggccgagcgcccccaggagtgggccatggagggcccccgcgacgggctgaagaaggagcggctactggacgaccgccacgacagcggcctggactccatgaaagacgaggagtacgagcagatggtcaaggagctgcaggagatccgcctcgagccgcaggaggtgccgcgcggctcggagccctggaagcagcagctcaccgaggacggggactcgttcctgcacttggccatcatccatgaagaaaaggcactgaccatggaagtgatccgccaggtgaagggagacctggccttcctcaacttccagaacaacctgcagcagactccactccacttggctgtgatcaccaaccagccagaaattgctgaggcacttctgggagctggctgtgatcctgagctccgagactttcgaggaaatacccccctacaccttgcctgtgagcagggctgcctggccagcgtgggagtcctgactcagtcctgcaccaccccgcacctccactccatcctgaaggctaccaactacaatggccacacgtgtctacacttagcctctatccatggctacctgggcatcgtggagcttttggtgtccttgggtgctgatgtcaatgctcaggagccctgtaatggccggactgcccttcacctcgcagtggacctgcaaaatcctgacctggtgtcactcctgttgaagtgtggggctgatgtcaacagagttacctaccagggctattctccctaccagctcacctggggccgcccaagcacccggatacagcagcagctgggccagctgacactagaaaaccttcagatgctgccagagagtgaggatgaggagagctatgacacagagtcagagttcacggagttcacagaggacgagctgccctatgatgactgtgtgtttggaggccagcgtctgacgttatga
• Sequence Length: 954

• Vector: pENTR223.1 or pUC
• Clone Sequence Report: Provided with product shipment

NCBI and Uniprot Product Information

• NCBI GI #: 33876916
• NCBI GeneID: 4792
• Molecular Weight: 35,609 Da
• NCBI Official Full Name: Homo sapiens nuclear factor of kappa light polypeptide gene enhancer in B-cells inhibitor, alpha, mRNA
• NCBI Official Synonym Full Names: NFKB inhibitor alpha
• NCBI Official Symbol: NFKBIA
• NCBI Official Synonym Symbols: IKBA; MAD-3; NFKBI
• NCBI Protein Information: NF-kappa-B inhibitor alpha
• UniProt Protein Name: NF-kappa-B inhibitor alpha
• Protein Family: NF-kappa-B inhibitor
• UniProt Gene Name: NFKBIA
• UniProt Synonym Gene Names: IKBA; MAD3; NFKBI; IkB-alpha; IkappaBalpha
• UniProt Entry Name: IKBA_HUMAN

NCBI Description

This gene encodes a member of the NF-kappa-B inhibitor family, which contain multiple ankrin repeat domains. The encoded protein interacts with REL dimers to inhibit NF-kappa-B/REL complexes which are involved in inflammatory responses. The encoded protein moves between the cytoplasm and the nucleus via a nuclear localization signal and CRM1-mediated nuclear export. Mutations in this gene have been found in ectodermal dysplasia anhidrotic with T-cell immunodeficiency autosomal dominant disease. [provided by RefSeq, Aug 2011]

Uniprot Description

IkB-alpha: a regulatory protein that inhibits NF-kappa-B by complexing with and trapping it in the cytoplasm. May be involved in regulation of transcriptional responses to NF-kappa-B, including cell adhesion, immune and proinflammatory responses, apoptosis, differentiation and growth. Controlled by sequential serine-phosphorylation, ubiquitination and degradation.

Protein type: DNA-binding; Inhibitor

Chromosomal Location of Human Ortholog: 14q13

Cellular Component: cytoplasm; cytosol; nucleus; plasma membrane

Molecular Function: enzyme binding; identical protein binding; NF-kappaB binding; nuclear localization sequence binding; protein binding; transcription factor binding; ubiquitin protein ligase binding

Biological Process: activation of NF-kappaB transcription factor; apoptosis; cytoplasmic sequestering of NF-kappaB; cytoplasmic sequestering of transcription factor; inhibition of NF-kappaB transcription factor; negative regulation of apoptosis; positive regulation of cellular protein metabolic process; positive regulation of transcription from RNA polymerase II promoter; stimulatory C-type lectin receptor signaling pathway; T cell receptor signaling pathway

Disease: Ectodermal Dysplasia, Anhidrotic, With T-cell Immunodeficiency, Autosomal Dominant