NFIB cdna clone
NFIB cDNA Clone
Gene Names
NFIB; CTF; NF1-B; NFI-B; NFIB2; NFIB3; NF-I/B; NFI-RED; HMGIC/NFIB
Synonyms
NFIB; NFIB cDNA Clone; NFIB cdna clone
Sequence
atgatgtattctcccatctgtctcactcaggatgaatttcacccattcatcgaggcacttcttccacatgtccgtgcaattgcctatacttggttcaacctgcaggctcgaaaacgcaagtactttaaaaagcatgagaagcgaatgtcaaaggatgaagaaagagcagtcaaagatgagcttctcagtgaaaagcctgaaatcaaacagaagtgggcatccaggctccttgccaaactgcgcaaagatattcgccaggagtatcgagaggactttgtgctcaccgtgactggcaagaagcacccgtgctgtgtcttatccaatcccgaccagaagggtaagattaggagaatcgactgcctgcgacaggcagacaaagtctggcgtctggatctagtcatggtgatcctgttcaaaggcatccccttggaaagtaccgatggagagcggctcatgaaatccccacattgcacaaacccagcactttgtgtccagccacatcatatcacagtatcagttaaggagcttgatttgtttttggcatactacgtgcaggagcaagattctggacaatcaggaagtccaagccacaatgatcctgccaagaatcctccaggttaccttgaggatagttttgtaaaatctggagtcttcaatgtatcagaacttgtaagagtatccagaacgcccataacccagggaactggagtcaacttcccaattggagaaatcccaagccaaccatactatcatgacatgaactcgggggtcaatcttcagaggtctctgtcttctccaccaagcagcaaaagacccaaaactatatccatagatgaaaatatggaaccaagtcctacaggagacttttacccctctccaagttcaccagctgctggaagtcgaacatggcacgaaagagatcaagatatgtcttctccgactactatgaagaagcctgaaaagccattgttcagctctgcatctccacaggattcttccccaagactgagcactttcccccagcaccaccatcccggaatacctggagttgcacacagtgtcatctcaactcgaactccacctccaccttcaccgttgccatttccaacacaagctatccttcctccagccccatcgagctacttttctcatccaacaatcagatatcctccccacctgaatcctcaggatactctgaagaactatgtaccttcttatgacccatccagtccacaaaccagccagtcctggtacctgggctag
Sequence Length
1263
Vector
pENTR223.1
Clone Sequence Report
Provided with product shipment
NCBI and Uniprot Product Information
NCBI GI #
NCBI GeneID
Molecular Weight
33,525 Da
NCBI Official Full Name
Homo sapiens nuclear factor I/B, mRNA
NCBI Official Synonym Full Names
nuclear factor I B
NCBI Official Symbol
NFIB
NCBI Official Synonym Symbols
CTF; NF1-B; NFI-B; NFIB2; NFIB3; NF-I/B; NFI-RED; HMGIC/NFIB
NCBI Protein Information
nuclear factor 1 B-type
UniProt Protein Name
Nuclear factor 1 B-type
Protein Family
UniProt Gene Name
NFIB
UniProt Synonym Gene Names
NF1-B; Nuclear factor 1/B; CTF; NF-I/B; NFI-B
UniProt Entry Name
NFIB_HUMAN
Uniprot Description
NFI-B: Recognizes and binds the palindromic sequence 5'- TTGGCNNNNNGCCAA-3' present in viral and cellular promoters and in the origin of replication of adenovirus type 2. These proteins are individually capable of activating transcription and replication. Belongs to the CTF/NF-I family. 3 isoforms of the human protein are produced by alternative splicing.
Protein type: DNA-binding
Chromosomal Location of Human Ortholog: 9p24.1
Cellular Component: nucleolus; nucleus
Molecular Function: DNA binding
Biological Process: anterior commissure morphogenesis; chondrocyte differentiation; glial cell differentiation; pontine nucleus development; positive regulation of transcription from RNA polymerase II promoter
Research Articles on NFIB
Similar Products
Product Notes
The NFIB nfib (Catalog #AAA1276365) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgatgtatt ctcccatctg tctcactcag gatgaatttc acccattcat cgaggcactt cttccacatg tccgtgcaat tgcctatact tggttcaacc tgcaggctcg aaaacgcaag tactttaaaa agcatgagaa gcgaatgtca aaggatgaag aaagagcagt caaagatgag cttctcagtg aaaagcctga aatcaaacag aagtgggcat ccaggctcct tgccaaactg cgcaaagata ttcgccagga gtatcgagag gactttgtgc tcaccgtgac tggcaagaag cacccgtgct gtgtcttatc caatcccgac cagaagggta agattaggag aatcgactgc ctgcgacagg cagacaaagt ctggcgtctg gatctagtca tggtgatcct gttcaaaggc atccccttgg aaagtaccga tggagagcgg ctcatgaaat ccccacattg cacaaaccca gcactttgtg tccagccaca tcatatcaca gtatcagtta aggagcttga tttgtttttg gcatactacg tgcaggagca agattctgga caatcaggaa gtccaagcca caatgatcct gccaagaatc ctccaggtta ccttgaggat agttttgtaa aatctggagt cttcaatgta tcagaacttg taagagtatc cagaacgccc ataacccagg gaactggagt caacttccca attggagaaa tcccaagcca accatactat catgacatga actcgggggt caatcttcag aggtctctgt cttctccacc aagcagcaaa agacccaaaa ctatatccat agatgaaaat atggaaccaa gtcctacagg agacttttac ccctctccaa gttcaccagc tgctggaagt cgaacatggc acgaaagaga tcaagatatg tcttctccga ctactatgaa gaagcctgaa aagccattgt tcagctctgc atctccacag gattcttccc caagactgag cactttcccc cagcaccacc atcccggaat acctggagtt gcacacagtg tcatctcaac tcgaactcca cctccacctt caccgttgcc atttccaaca caagctatcc ttcctccagc cccatcgagc tacttttctc atccaacaat cagatatcct ccccacctga atcctcagga tactctgaag aactatgtac cttcttatga cccatccagt ccacaaacca gccagtcctg gtacctgggc tag. It is sometimes possible for the material contained within the vial of "NFIB, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.Precautions
All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.Disclaimer
Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.Item has been added to Shopping Cart
If you are ready to order, navigate to Shopping Cart and get ready to checkout.
