Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

NDRG1 cdna clone

NDRG1 cDNA Clone

Gene Names
NDRG1; GC4; RTP; DRG1; NDR1; NMSL; TDD5; CAP43; CMT4D; DRG-1; HMSNL; RIT42; TARG1; PROXY1
Synonyms
NDRG1; NDRG1 cDNA Clone; NDRG1 cdna clone
Ordering
For Research Use Only!
Sequence
atgtctcgggagatgcaggatgtagacctcgctgaggtgaagcctttggtggagaaaggggagaccatcaccggcctcctgcaagagtttgatgtccaggagcaggacatcgagactttacatggctctgttcacgtcacgctgtgtgggactcccaagggaaaccggcctgtcatcctcacctaccatgacatcggcatgaaccacaaaacctgctacaaccccctcttcaactacgaggacatgcaggagatcacccagcactttgccgtctgccacgtggacgcccctggccagcaggacggcgcagcctccttccccgcagggtacatgtacccctccatggatcagctggctgaaatgcttcctggagtccttcaacagtttgggctgaaaagcattattggcatgggaacaggagcaggcgcctacatcctaactcgatttgctctaaacaaccctgagatggtggagggccttgtccttatcaacgtgaacccttgtgcggaaggctggatggactgggccgcctccaagatctcaggatggacccaagctctgccggacatggtggtgtcccacctttttgggaaggaagaaatgcagagtaacgtggaagtggtccacacctaccgccagcacattgtgaatgacatgaaccccggcaacctgcacctgttcatcaatgcctacaacagccggcgcgacctggagattgagcgaccaatgccgggaacccacacagtcaccctgcagtgccctgctctgttggtggttggggacagctcgcctgcagtggatgccgtggtggagtgcaactcaaaattggacccaacaaagaccactctcctcaagatggcggactgtggcggcctcccgcagatctcccagccggccaagctcgctgaggccttcaagtacttcgtgcagggcatgggatacatgccctcggctagcatgacccgcctgatgcggtcccgcacagcctctggttccagcgtcacttctctggatggcacccgcagccgctcccacaccagcgagggcacccgaagccgctcccacaccagcgagggcacccgcagccgctcgcacaccagcgagggggcccacctggacatcacccccaactcgggtgctgctgggaacagcgccgggcccaagtccatggaggtctcctgctag
Sequence Length
1185
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
33,650 Da
NCBI Official Full Name
Homo sapiens N-myc downstream regulated 1, mRNA
NCBI Official Synonym Full Names
N-myc downstream regulated 1
NCBI Official Symbol
NDRG1
NCBI Official Synonym Symbols
GC4; RTP; DRG1; NDR1; NMSL; TDD5; CAP43; CMT4D; DRG-1; HMSNL; RIT42; TARG1; PROXY1
NCBI Protein Information
protein NDRG1
UniProt Protein Name
Protein NDRG1
Protein Family
UniProt Gene Name
NDRG1
UniProt Synonym Gene Names
CAP43; DRG1; RTP; DRG-1; RTP
UniProt Entry Name
NDRG1_HUMAN

NCBI Description

This gene is a member of the N-myc downregulated gene family which belongs to the alpha/beta hydrolase superfamily. The protein encoded by this gene is a cytoplasmic protein involved in stress responses, hormone responses, cell growth, and differentiation. The encoded protein is necessary for p53-mediated caspase activation and apoptosis. Mutations in this gene are a cause of Charcot-Marie-Tooth disease type 4D, and expression of this gene may be a prognostic indicator for several types of cancer. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, May 2012]

Uniprot Description

NDRG1: a hypoxia-inducible anti-apoptotic protein. Promotes proliferation and correlates with invasion, metastasis and poor prognosis in many cancers. Is involved in growth arrest and cell differentiation during development. A ubiquitous Rab4a effector protein that modulates angiogenesis and is involved in vesicular recycling of E-cadherin. Colocalizes with transferrin during the recycling in cells. NDRG1 knockdown delays the recycling rate of transferrin, while its overexpression increases the rate of transferrin recycling. Interacts with SIRT1/p53 signaling to attenuate hypoxic injury in human trophoblasts. Its expression is induced by an elevation of free intracellular calcium ion caused by nickel ion exposure. Highly expressed in placental membranes, prostate, kidney, small intestine, ovary, peripheral nerves and Schwann cells. Defects in NDRG1 are the cause of Charcot-Marie-Tooth disease type 4D (CMT4D).

Protein type: Vesicle; Cell development/differentiation

Chromosomal Location of Human Ortholog: 8q24.3

Cellular Component: cell-cell adherens junction; centrosome; cytoplasm; cytosol; microtubule; microtubule cytoskeleton; nucleus; perinuclear region of cytoplasm; plasma membrane; recycling endosome membrane

Molecular Function: cadherin binding; gamma-tubulin binding; microtubule binding; protein binding; Rab GTPase binding

Biological Process: DNA damage response, signal transduction by p53 class mediator; regulation of apoptosis; response to metal ion

Disease: Charcot-marie-tooth Disease, Type 4d

Research Articles on NDRG1

Similar Products

Product Notes

The NDRG1 ndrg1 (Catalog #AAA1278473) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgtctcggg agatgcagga tgtagacctc gctgaggtga agcctttggt ggagaaaggg gagaccatca ccggcctcct gcaagagttt gatgtccagg agcaggacat cgagacttta catggctctg ttcacgtcac gctgtgtggg actcccaagg gaaaccggcc tgtcatcctc acctaccatg acatcggcat gaaccacaaa acctgctaca accccctctt caactacgag gacatgcagg agatcaccca gcactttgcc gtctgccacg tggacgcccc tggccagcag gacggcgcag cctccttccc cgcagggtac atgtacccct ccatggatca gctggctgaa atgcttcctg gagtccttca acagtttggg ctgaaaagca ttattggcat gggaacagga gcaggcgcct acatcctaac tcgatttgct ctaaacaacc ctgagatggt ggagggcctt gtccttatca acgtgaaccc ttgtgcggaa ggctggatgg actgggccgc ctccaagatc tcaggatgga cccaagctct gccggacatg gtggtgtccc acctttttgg gaaggaagaa atgcagagta acgtggaagt ggtccacacc taccgccagc acattgtgaa tgacatgaac cccggcaacc tgcacctgtt catcaatgcc tacaacagcc ggcgcgacct ggagattgag cgaccaatgc cgggaaccca cacagtcacc ctgcagtgcc ctgctctgtt ggtggttggg gacagctcgc ctgcagtgga tgccgtggtg gagtgcaact caaaattgga cccaacaaag accactctcc tcaagatggc ggactgtggc ggcctcccgc agatctccca gccggccaag ctcgctgagg ccttcaagta cttcgtgcag ggcatgggat acatgccctc ggctagcatg acccgcctga tgcggtcccg cacagcctct ggttccagcg tcacttctct ggatggcacc cgcagccgct cccacaccag cgagggcacc cgaagccgct cccacaccag cgagggcacc cgcagccgct cgcacaccag cgagggggcc cacctggaca tcacccccaa ctcgggtgct gctgggaaca gcgccgggcc caagtccatg gaggtctcct gctag. It is sometimes possible for the material contained within the vial of "NDRG1, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.