NDOR1 cdna clone
NDOR1 cDNA Clone
Gene Names
NDOR1; NR1; bA350O14.9
Synonyms
NDOR1; NDOR1 cDNA Clone; NDOR1 cdna clone
Sequence
atgccgagcccgcagcttctggtgctcttcggcagccagacaggcacggctcaggatgtgtcggagagactgggtcgcgaggcccggcgccggcggcttggctgccgggtgcaggccctggactcctacccggtggtgaatctgattaacgagcccctggtgatatttgtttgtgcaactacaggccaaggagacccccctgacaacatgaagaacttctggaggtttatattccggaagaacctgccctccactgccctctgtcagatggactttgccgtcctgggcctcggggactcctcatacgccaagttcaacttcgtggccaagaagctgcaccgacggctactgcagcttgggggcagcgccctcctgcccgtgtgcctgggcgatgaccagcatgagctggggcccgacgctgctgtggacccctggctgcgagacttgtgggacagggttctggggctgtacccgccgcctccgggcctcactgagatccctcccggagtccccctgccctccaagttcaccctgctgttcctccaagaggcacccagcacgggctctgaggggcagcgggtagctcaccccggctctcaggagcccccgtcagagtcgaagcccttcctagcacccatgatctccaaccagagagtcaccggcccctcccacttccaggacgttcggctgattgagtttgacatcttgggctctggcatcagctttgctgctggtgatgtggtgctgattcagccctccaactcggctgcccatgtccagcggttctgccaggtgctgggcctggaccctgaccagctcttcatgctgcagccgcgggagccagatgtctcctcccccacgaggctgccccagccctgctccatgcggcacctcgtgtcccactacctggacatcgccagcgtgcctcgccgctccttcttcgaactcctggcctgtctatccctccatgagctggagcgggagaagctgctggagttcagttctgcccaaggccaggaggagctctttgaatactgcaaccggccccgcaggaccatcctggaggtgctctgtgacttcccgcacacagctgccgccatccctcccgactacctgttggacctcatccccgttatccggccgagggccttctccatcgcctcctcgctgctgactcacccctcacggctgcagatcctcgtggctgtagtgcagttccagactcgcctcaaggagccccgccggggcctctgctcctcctggctggcatccctggaccctgggcaaggacctgtccgggtgcccctctgggtgcggcctgggagtctggccttcccagagacaccagacacacctgtgatcatggtggggcctggcactggggtagcccccttccgagcagccatccaggagcgtgtggcccagggccagactggaaacttcttgttttttggctgccgctggcgggaccaagacttctactgggaggctgagtggcaggagctggagaagcgggactgtctgaccctcatccctgccttctcccgggaacaggagcagaaaatatatgtgcagcaccggctccgggagctggggtcgcttgtgtgggaactgctggaccgccagggtgcatacttctacctggcaggcaacgccaagtccatgccagcggacgtctcggaagccctgatgtccatcttccaggaggagggtggactctgcagcccggacgcagccgcgtatctagccaggctccagcagacacggcgcttccagacagagacgtgggcctga
Sequence Length
1794
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment
NCBI and Uniprot Product Information
NCBI GI #
NCBI GeneID
Molecular Weight
65,943 Da
NCBI Official Full Name
Homo sapiens NADPH dependent diflavin oxidoreductase 1, mRNA
NCBI Official Synonym Full Names
NADPH dependent diflavin oxidoreductase 1
NCBI Official Symbol
NDOR1
NCBI Official Synonym Symbols
NR1; bA350O14.9
NCBI Protein Information
NADPH-dependent diflavin oxidoreductase 1
UniProt Protein Name
NADPH-dependent diflavin oxidoreductase 1
UniProt Gene Name
NDOR1
UniProt Entry Name
NDOR1_HUMAN
NCBI Description
This gene encodes an NADPH-dependent diflavin reductase that contains both flavin mononucleotide (FMN) and flavin adenine dinucleotide (FAD) binding domains. The encoded protein catalyzes the transfer of electrons from NADPH through FAD and FMN cofactors to potential redox partners. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Mar 2012]
Uniprot Description
NDOR1: Oxidoreductase that catalyzes the NADP-dependent reduction of cytochrome c and one-electron acceptors, such as doxorubicin, potassium ferricyanide and menadione (in vitro). 2 isoforms of the human protein are produced by alternative splicing.
Protein type: EC 1.6.-.-; Oxidoreductase
Chromosomal Location of Human Ortholog: 9q34.3
Cellular Component: cytoplasm; cytosol; intermediate filament cytoskeleton; nucleus
Molecular Function: FAD binding; FMN binding; NADP binding; oxidoreductase activity; protein binding
Biological Process: cell death
Research Articles on NDOR1
Similar Products
Product Notes
The NDOR1 ndor1 (Catalog #AAA1271937) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgccgagcc cgcagcttct ggtgctcttc ggcagccaga caggcacggc tcaggatgtg tcggagagac tgggtcgcga ggcccggcgc cggcggcttg gctgccgggt gcaggccctg gactcctacc cggtggtgaa tctgattaac gagcccctgg tgatatttgt ttgtgcaact acaggccaag gagacccccc tgacaacatg aagaacttct ggaggtttat attccggaag aacctgccct ccactgccct ctgtcagatg gactttgccg tcctgggcct cggggactcc tcatacgcca agttcaactt cgtggccaag aagctgcacc gacggctact gcagcttggg ggcagcgccc tcctgcccgt gtgcctgggc gatgaccagc atgagctggg gcccgacgct gctgtggacc cctggctgcg agacttgtgg gacagggttc tggggctgta cccgccgcct ccgggcctca ctgagatccc tcccggagtc cccctgccct ccaagttcac cctgctgttc ctccaagagg cacccagcac gggctctgag gggcagcggg tagctcaccc cggctctcag gagcccccgt cagagtcgaa gcccttccta gcacccatga tctccaacca gagagtcacc ggcccctccc acttccagga cgttcggctg attgagtttg acatcttggg ctctggcatc agctttgctg ctggtgatgt ggtgctgatt cagccctcca actcggctgc ccatgtccag cggttctgcc aggtgctggg cctggaccct gaccagctct tcatgctgca gccgcgggag ccagatgtct cctcccccac gaggctgccc cagccctgct ccatgcggca cctcgtgtcc cactacctgg acatcgccag cgtgcctcgc cgctccttct tcgaactcct ggcctgtcta tccctccatg agctggagcg ggagaagctg ctggagttca gttctgccca aggccaggag gagctctttg aatactgcaa ccggccccgc aggaccatcc tggaggtgct ctgtgacttc ccgcacacag ctgccgccat ccctcccgac tacctgttgg acctcatccc cgttatccgg ccgagggcct tctccatcgc ctcctcgctg ctgactcacc cctcacggct gcagatcctc gtggctgtag tgcagttcca gactcgcctc aaggagcccc gccggggcct ctgctcctcc tggctggcat ccctggaccc tgggcaagga cctgtccggg tgcccctctg ggtgcggcct gggagtctgg ccttcccaga gacaccagac acacctgtga tcatggtggg gcctggcact ggggtagccc ccttccgagc agccatccag gagcgtgtgg cccagggcca gactggaaac ttcttgtttt ttggctgccg ctggcgggac caagacttct actgggaggc tgagtggcag gagctggaga agcgggactg tctgaccctc atccctgcct tctcccggga acaggagcag aaaatatatg tgcagcaccg gctccgggag ctggggtcgc ttgtgtggga actgctggac cgccagggtg catacttcta cctggcaggc aacgccaagt ccatgccagc ggacgtctcg gaagccctga tgtccatctt ccaggaggag ggtggactct gcagcccgga cgcagccgcg tatctagcca ggctccagca gacacggcgc ttccagacag agacgtgggc ctga. It is sometimes possible for the material contained within the vial of "NDOR1, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.Precautions
All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.Disclaimer
Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.Item has been added to Shopping Cart
If you are ready to order, navigate to Shopping Cart and get ready to checkout.
