Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

NCF2 cdna clone

NCF2 cDNA Clone

Gene Names
NCF2; NCF-2; NOXA2; P67PHOX; P67-PHOX
Synonyms
NCF2; NCF2 cDNA Clone; NCF2 cdna clone
Ordering
For Research Use Only!
Sequence
atgtccctggtggaggccatcagcctctggaatgaaggggtgctggcagcggacaagaaggactggaagggagccctggatgccttcagtgccgtccaggacccccactcccggatttgcttcaacattggctgcatgtacactatcctgaagaacatgactgaagcagagaaggcctttaccagaagcattaaccgagacaagcacttggcagtggcttacttccaacgagggatgctctactaccagacagagaaatatgatttggctatcaaagaccttaaagaagccttgattcagcttcgagggaaccagctgatagactataagatcctggggctccagttcaagctgtttgcctgtgaggtgttatataacattgctttcatgtatgccaagaaggaggaatggaaaaaagctgaagaacagttagcattggccacgagcatgaagtctgagcccagacattccaaaatcgacaaggcgatggagtgtgtctggaagcagaagctatatgagccagtggtgatccctgtgggcaggctgtttcgaccaaatgagagacaagtggctcagctggccaagaaggattacctaggcaaggcaacggtcgtggcatctgtggtggatcaagacagtttctctgggtttgcccctctgcaaccacaggcagctgagcctccacccagaccgaaaaccccagagatcttcagggctctggaaggggaggctcaccgtgtgctatttgggtttgtgcctgagacaaaagaagagctccaggtcatgccagggaacattgtctttgtcttgaagaagggcaatgataactgggccacggtcatgttcaacgggcagaaggggcttgttccctgcaactaccttgaaccagttgagctgcggatccaccctcagcagcagccccaggaggaaagctctccgcagtccgacatcccagctcctcctagttccaaagcccctggaagaccccagctgtcaccaggccagaaacaaaaagaagagcctaaggaagtgaagctcagtgttcccatgccctacacactcaaggtgcactacaagtacacggtagtcatgaagactcagcccgggctcccctacagccaggtccgggacatggtgtctaagaaactggagctccggctggaacaaactaagctgagctatcggcctcgggacagcaatgagctggtgcccctttcagaagacagcatgaaggatgcctggggccaggtgaaaaactactgcctgactctgtggtgtgagaacacagtgggtgaccaaggctttccagatgaacccaaggaaagtgaaaaagctgatgctaataaccagacaacagaacctcagcttaagaaaggcagccaagtggaggcactcttcagttatgaggctacccaaccagaggacctggagtttcaggaaggggatataatcctggtgttatcaaaggtgaatgaagaatggctggaaggggagtgcaaagggaaggtgggcattttccccaaagtttttgttgaagactgcgcaactacagatttggaaagcactcggagagaagtctag
Sequence Length
1581
Vector
pENTR223.1
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
50,337 Da
NCBI Official Full Name
Homo sapiens neutrophil cytosolic factor 2, mRNA
NCBI Official Synonym Full Names
neutrophil cytosolic factor 2
NCBI Official Symbol
NCF2
NCBI Official Synonym Symbols
NCF-2; NOXA2; P67PHOX; P67-PHOX
NCBI Protein Information
neutrophil cytosol factor 2
UniProt Protein Name
Neutrophil cytosol factor 2
Protein Family
UniProt Gene Name
NCF2
UniProt Synonym Gene Names
NOXA2; P67PHOX; NCF-2
UniProt Entry Name
NCF2_HUMAN

NCBI Description

This gene encodes neutrophil cytosolic factor 2, the 67-kilodalton cytosolic subunit of the multi-protein NADPH oxidase complex found in neutrophils. This oxidase produces a burst of superoxide which is delivered to the lumen of the neutrophil phagosome. Mutations in this gene, as well as in other NADPH oxidase subunits, can result in chronic granulomatous disease, a disease that causes recurrent infections by catalase-positive organisms. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Jun 2010]

Uniprot Description

p67phox: NCF2, NCF1, and a membrane bound cytochrome b558 are required for activation of the latent NADPH oxidase (necessary for superoxide production). Interacts with SYTL1 and RAC1. Interacts with NCF4. May interact with NOXO1. Belongs to the NCF2/NOXA1 family.

Protein type: Oxidoreductase

Chromosomal Location of Human Ortholog: 1q25

Cellular Component: cytoplasm; cytosol; NADPH oxidase complex; nucleolus

Molecular Function: electron carrier activity; protein binding; protein C-terminus binding

Biological Process: antigen processing and presentation of exogenous peptide antigen via MHC class I, TAP-dependent; cell redox homeostasis; cellular defense response; innate immune response; respiratory burst; superoxide metabolic process; superoxide release; vascular endothelial growth factor receptor signaling pathway

Disease: Granulomatous Disease, Chronic, Autosomal Recessive, Cytochrome B-positive, Type Ii

Research Articles on NCF2

Similar Products

Product Notes

The NCF2 ncf2 (Catalog #AAA1266713) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgtccctgg tggaggccat cagcctctgg aatgaagggg tgctggcagc ggacaagaag gactggaagg gagccctgga tgccttcagt gccgtccagg acccccactc ccggatttgc ttcaacattg gctgcatgta cactatcctg aagaacatga ctgaagcaga gaaggccttt accagaagca ttaaccgaga caagcacttg gcagtggctt acttccaacg agggatgctc tactaccaga cagagaaata tgatttggct atcaaagacc ttaaagaagc cttgattcag cttcgaggga accagctgat agactataag atcctggggc tccagttcaa gctgtttgcc tgtgaggtgt tatataacat tgctttcatg tatgccaaga aggaggaatg gaaaaaagct gaagaacagt tagcattggc cacgagcatg aagtctgagc ccagacattc caaaatcgac aaggcgatgg agtgtgtctg gaagcagaag ctatatgagc cagtggtgat ccctgtgggc aggctgtttc gaccaaatga gagacaagtg gctcagctgg ccaagaagga ttacctaggc aaggcaacgg tcgtggcatc tgtggtggat caagacagtt tctctgggtt tgcccctctg caaccacagg cagctgagcc tccacccaga ccgaaaaccc cagagatctt cagggctctg gaaggggagg ctcaccgtgt gctatttggg tttgtgcctg agacaaaaga agagctccag gtcatgccag ggaacattgt ctttgtcttg aagaagggca atgataactg ggccacggtc atgttcaacg ggcagaaggg gcttgttccc tgcaactacc ttgaaccagt tgagctgcgg atccaccctc agcagcagcc ccaggaggaa agctctccgc agtccgacat cccagctcct cctagttcca aagcccctgg aagaccccag ctgtcaccag gccagaaaca aaaagaagag cctaaggaag tgaagctcag tgttcccatg ccctacacac tcaaggtgca ctacaagtac acggtagtca tgaagactca gcccgggctc ccctacagcc aggtccggga catggtgtct aagaaactgg agctccggct ggaacaaact aagctgagct atcggcctcg ggacagcaat gagctggtgc ccctttcaga agacagcatg aaggatgcct ggggccaggt gaaaaactac tgcctgactc tgtggtgtga gaacacagtg ggtgaccaag gctttccaga tgaacccaag gaaagtgaaa aagctgatgc taataaccag acaacagaac ctcagcttaa gaaaggcagc caagtggagg cactcttcag ttatgaggct acccaaccag aggacctgga gtttcaggaa ggggatataa tcctggtgtt atcaaaggtg aatgaagaat ggctggaagg ggagtgcaaa gggaaggtgg gcattttccc caaagttttt gttgaagact gcgcaactac agatttggaa agcactcgga gagaagtcta g. It is sometimes possible for the material contained within the vial of "NCF2, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.