Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

NCF1 cdna clone

NCF1 cDNA Clone

Gene Names
NCF1; NCF1A; NOXO2; p47phox; SH3PXD1A
Synonyms
NCF1; NCF1 cDNA Clone; NCF1 cdna clone
Ordering
For Research Use Only!
Sequence
atgggggacaccttcatccgtcacatcgccctgctgggctttgagaagcgcttcgtacccagccagcactatgtgtacatgttcctggtgaaatggcaggacctgtcggagaaggtggtctaccggcgcttcaccgagatctacgagttccataaaaccttaaaagaaatgttccctattgaggcaggggcgatcaatccagagaacaggatcatcccccacctcccagctcccaagtggtttgacgggcagcgggccgccgagaaccgccagggcacacttaccgagtactgcagcacgctcatgagcctgcccaccaagatctcccgctgtccccacctcctcgacttcttcaaggtgcgccctgatgacctcaagctccccacggacaaccagacaaaaaagccagagacatacttgatgcccaaagatggcaagagtaccgcgacagacatcaccggccccatcatcctgcagacgtaccgcgccattgccaactacgagaagacctcgggctccgagatggctctgtccacgggggacgtggtggaggtcgtagagaagagcgagagcggttggtggttctgtcagatgaaagcaaagcgaggctggatcccagcgtccttcctcgagcccctggacagtcctgacgagacggaagaccctgagcccaactatgcaggtgagccatacgtcgccatcaaggcctacactgctgtggagggggacgaggtgtccctgctcgagggtgaagctgttgaggtcattcacaagctcctggacggctggtgggtcatcaggaaagacgacgtcacaggctacttcccgtccatgtacctgcaaaagtcagggcaagacgtgtcccaggcccaacgccagatcaagcggggggcgccgccccgcaggtcgtccatccgcaacgcgcacagcatccaccagcggtcgcggaagcgcctcagccaggacgcctatcgccgcaacagcgtccgttttctgcagcagcgacgccgccaggcgcggccgggaccgcagagccccgggagcccgctcgaggaggagcggcagacgcagcgctctaaaccgcagccggcggtgcccccgcggccgagcgccgacctcatcctgaaccgctgcagcgagagcaccaagcggaagctggcgtctgccgtctga
Sequence Length
1173
Vector
Please Inquire

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
30,781 Da
NCBI Official Full Name
Homo sapiens neutrophil cytosolic factor 1, mRNA
NCBI Official Synonym Full Names
neutrophil cytosolic factor 1
NCBI Official Symbol
NCF1
NCBI Official Synonym Symbols
NCF1A; NOXO2; p47phox; SH3PXD1A
NCBI Protein Information
neutrophil cytosol factor 1
UniProt Protein Name
Neutrophil cytosol factor 1
Protein Family
UniProt Gene Name
NCF1
UniProt Synonym Gene Names
NOXO2; SH3PXD1A; NCF-1
UniProt Entry Name
NCF1_HUMAN

NCBI Description

The protein encoded by this gene is a 47 kDa cytosolic subunit of neutrophil NADPH oxidase. This oxidase is a multicomponent enzyme that is activated to produce superoxide anion. Mutations in this gene have been associated with chronic granulomatous disease. [provided by RefSeq, Jul 2008]

Uniprot Description

p47phox: the 47-kilodalton cytosolic subunit of the multi-protein complex known as NADPH oxidase found in neutrophils. The holo-oxidase produces a burst of superoxide which is delivered to the lumen of the neutrophil phagosome. Contains 2 SH2 domains. Mutations in NCF1, as well as in other NADPH oxidase subunits, can result in chronic granulomatous disease.

Protein type: Oxidoreductase; EC 1.-.-.-

Chromosomal Location of Human Ortholog: 7q11.23

Cellular Component: cytosol; extrinsic to membrane; NADPH oxidase complex

Molecular Function: electron carrier activity; phosphatidylinositol-3,4-bisphosphate binding; phosphoinositide binding; protein binding; SH3 domain binding; superoxide-generating NADPH oxidase activator activity; superoxide-generating NADPH oxidase activity

Biological Process: antigen processing and presentation of exogenous peptide antigen via MHC class I, TAP-dependent; cell redox homeostasis; cellular defense response; innate immune response; protein targeting to membrane; respiratory burst; superoxide metabolic process; superoxide release; vascular endothelial growth factor receptor signaling pathway

Disease: Granulomatous Disease, Chronic, Autosomal Recessive, Cytochrome B-positive, Type I

Research Articles on NCF1

Similar Products

Product Notes

The NCF1 ncf1 (Catalog #AAA1267873) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgggggaca ccttcatccg tcacatcgcc ctgctgggct ttgagaagcg cttcgtaccc agccagcact atgtgtacat gttcctggtg aaatggcagg acctgtcgga gaaggtggtc taccggcgct tcaccgagat ctacgagttc cataaaacct taaaagaaat gttccctatt gaggcagggg cgatcaatcc agagaacagg atcatccccc acctcccagc tcccaagtgg tttgacgggc agcgggccgc cgagaaccgc cagggcacac ttaccgagta ctgcagcacg ctcatgagcc tgcccaccaa gatctcccgc tgtccccacc tcctcgactt cttcaaggtg cgccctgatg acctcaagct ccccacggac aaccagacaa aaaagccaga gacatacttg atgcccaaag atggcaagag taccgcgaca gacatcaccg gccccatcat cctgcagacg taccgcgcca ttgccaacta cgagaagacc tcgggctccg agatggctct gtccacgggg gacgtggtgg aggtcgtaga gaagagcgag agcggttggt ggttctgtca gatgaaagca aagcgaggct ggatcccagc gtccttcctc gagcccctgg acagtcctga cgagacggaa gaccctgagc ccaactatgc aggtgagcca tacgtcgcca tcaaggccta cactgctgtg gagggggacg aggtgtccct gctcgagggt gaagctgttg aggtcattca caagctcctg gacggctggt gggtcatcag gaaagacgac gtcacaggct acttcccgtc catgtacctg caaaagtcag ggcaagacgt gtcccaggcc caacgccaga tcaagcgggg ggcgccgccc cgcaggtcgt ccatccgcaa cgcgcacagc atccaccagc ggtcgcggaa gcgcctcagc caggacgcct atcgccgcaa cagcgtccgt tttctgcagc agcgacgccg ccaggcgcgg ccgggaccgc agagccccgg gagcccgctc gaggaggagc ggcagacgca gcgctctaaa ccgcagccgg cggtgccccc gcggccgagc gccgacctca tcctgaaccg ctgcagcgag agcaccaagc ggaagctggc gtctgccgtc tga. It is sometimes possible for the material contained within the vial of "NCF1, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.