NCF1 cdna clone

NCF1 cDNA Clone

Gene Names

NCF1; NCF1A; NOXO2; p47phox; SH3PXD1A

Synonyms

NCF1; NCF1 cDNA Clone; NCF1 cdna clone

Ordering
Cat. Num. AAA1267873 When autocomplete results are available use up and down arrows to review and enter to select. Touch device users, explore by touch or with swipe gestures. For Research Use Only!

Sequence

atgggggacaccttcatccgtcacatcgccctgctgggctttgagaagcgcttcgtacccagccagcactatgtgtacatgttcctggtgaaatggcaggacctgtcggagaaggtggtctaccggcgcttcaccgagatctacgagttccataaaaccttaaaagaaatgttccctattgaggcaggggcgatcaatccagagaacaggatcatcccccacctcccagctcccaagtggtttgacgggcagcgggccgccgagaaccgccagggcacacttaccgagtactgcagcacgctcatgagcctgcccaccaagatctcccgctgtccccacctcctcgacttcttcaaggtgcgccctgatgacctcaagctccccacggacaaccagacaaaaaagccagagacatacttgatgcccaaagatggcaagagtaccgcgacagacatcaccggccccatcatcctgcagacgtaccgcgccattgccaactacgagaagacctcgggctccgagatggctctgtccacgggggacgtggtggaggtcgtagagaagagcgagagcggttggtggttctgtcagatgaaagcaaagcgaggctggatcccagcgtccttcctcgagcccctggacagtcctgacgagacggaagaccctgagcccaactatgcaggtgagccatacgtcgccatcaaggcctacactgctgtggagggggacgaggtgtccctgctcgagggtgaagctgttgaggtcattcacaagctcctggacggctggtgggtcatcaggaaagacgacgtcacaggctacttcccgtccatgtacctgcaaaagtcagggcaagacgtgtcccaggcccaacgccagatcaagcggggggcgccgccccgcaggtcgtccatccgcaacgcgcacagcatccaccagcggtcgcggaagcgcctcagccaggacgcctatcgccgcaacagcgtccgttttctgcagcagcgacgccgccaggcgcggccgggaccgcagagccccgggagcccgctcgaggaggagcggcagacgcagcgctctaaaccgcagccggcggtgcccccgcggccgagcgccgacctcatcctgaaccgctgcagcgagagcaccaagcggaagctggcgtctgccgtctga

Sequence Length

1173

Vector

Please Inquire

NCBI and Uniprot Product Information

NCBI GI #

33877213

NCBI GeneID

653361

Molecular Weight

30,781 Da

NCBI Official Full Name

Homo sapiens neutrophil cytosolic factor 1, mRNA

NCBI Official Synonym Full Names

neutrophil cytosolic factor 1

NCBI Official Symbol

NCF1

NCBI Official Synonym Symbols

NCF1A; NOXO2; p47phox; SH3PXD1A

NCBI Protein Information

neutrophil cytosol factor 1

UniProt Protein Name

Neutrophil cytosol factor 1

Protein Family

Neutrophil cytosol factor

UniProt Gene Name

NCF1

UniProt Synonym Gene Names

NOXO2; SH3PXD1A; NCF-1

UniProt Entry Name

NCF1_HUMAN

NCBI Description

The protein encoded by this gene is a 47 kDa cytosolic subunit of neutrophil NADPH oxidase. This oxidase is a multicomponent enzyme that is activated to produce superoxide anion. Mutations in this gene have been associated with chronic granulomatous disease. [provided by RefSeq, Jul 2008]

Uniprot Description

p47phox: the 47-kilodalton cytosolic subunit of the multi-protein complex known as NADPH oxidase found in neutrophils. The holo-oxidase produces a burst of superoxide which is delivered to the lumen of the neutrophil phagosome. Contains 2 SH2 domains. Mutations in NCF1, as well as in other NADPH oxidase subunits, can result in chronic granulomatous disease.

Protein type: Oxidoreductase; EC 1.-.-.-

Chromosomal Location of Human Ortholog: 7q11.23

Cellular Component: cytosol; extrinsic to membrane; NADPH oxidase complex

Molecular Function: electron carrier activity; phosphatidylinositol-3,4-bisphosphate binding; phosphoinositide binding; protein binding; SH3 domain binding; superoxide-generating NADPH oxidase activator activity; superoxide-generating NADPH oxidase activity

Biological Process: antigen processing and presentation of exogenous peptide antigen via MHC class I, TAP-dependent; cell redox homeostasis; cellular defense response; innate immune response; protein targeting to membrane; respiratory burst; superoxide metabolic process; superoxide release; vascular endothelial growth factor receptor signaling pathway

Disease: Granulomatous Disease, Chronic, Autosomal Recessive, Cytochrome B-positive, Type I

Research Articles on NCF1

1. A rare mutation in NCF1 encoding p47phox of the leukocyte NADPH oxidase causes lack of superoxide generation, leads to chronic granulomatous disease and was recently (1200-2300 years ago) introduced into the Kavkazi Jewish population

Similar Products

NCF1 Recombinant Protein

Host: E Coli

Reactivity: n/a

Apps: Western Blot, ELISA

Product Notes

The NCF1 ncf1 (Catalog #AAA1267873) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgggggaca ccttcatccg tcacatcgcc ctgctgggct ttgagaagcg cttcgtaccc agccagcact atgtgtacat gttcctggtg aaatggcagg acctgtcgga gaaggtggtc taccggcgct tcaccgagat ctacgagttc cataaaacct taaaagaaat gttccctatt gaggcagggg cgatcaatcc agagaacagg atcatccccc acctcccagc tcccaagtgg tttgacgggc agcgggccgc cgagaaccgc cagggcacac ttaccgagta ctgcagcacg ctcatgagcc tgcccaccaa gatctcccgc tgtccccacc tcctcgactt cttcaaggtg cgccctgatg acctcaagct ccccacggac aaccagacaa aaaagccaga gacatacttg atgcccaaag atggcaagag taccgcgaca gacatcaccg gccccatcat cctgcagacg taccgcgcca ttgccaacta cgagaagacc tcgggctccg agatggctct gtccacgggg gacgtggtgg aggtcgtaga gaagagcgag agcggttggt ggttctgtca gatgaaagca aagcgaggct ggatcccagc gtccttcctc gagcccctgg acagtcctga cgagacggaa gaccctgagc ccaactatgc aggtgagcca tacgtcgcca tcaaggccta cactgctgtg gagggggacg aggtgtccct gctcgagggt gaagctgttg aggtcattca caagctcctg gacggctggt gggtcatcag gaaagacgac gtcacaggct acttcccgtc catgtacctg caaaagtcag ggcaagacgt gtcccaggcc caacgccaga tcaagcgggg ggcgccgccc cgcaggtcgt ccatccgcaa cgcgcacagc atccaccagc ggtcgcggaa gcgcctcagc caggacgcct atcgccgcaa cagcgtccgt tttctgcagc agcgacgccg ccaggcgcgg ccgggaccgc agagccccgg gagcccgctc gaggaggagc ggcagacgca gcgctctaaa ccgcagccgg cggtgccccc gcggccgagc gccgacctca tcctgaaccg ctgcagcgag agcaccaagc ggaagctggc gtctgccgtc tga. It is sometimes possible for the material contained within the vial of "NCF1, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Loading...