Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

NCAPG cdna clone

NCAPG cDNA Clone

Gene Names
NCAPG; CAPG; CHCG; YCG1; NY-MEL-3
Synonyms
NCAPG; NCAPG cDNA Clone; NCAPG cdna clone
Ordering
For Research Use Only!
Sequence
atgaatggaatcatcgaatctttgattcttcctggaataataagtattcatcctgttgtaagaaacctggctgttttatgcttgggatgctgtggactacagaatcaggattttgcaaggaaacacttcgtattactattgcaggttttgcaaattgatgatgtcacaataaaaataagtgctttaaaggcaatctttgaccaactgatgacgttcgggattgaaccatttaaaactaaaaaaatcaaaacacttcattgtgaaggtacagaaataaacagtgatgatgagcaagaatcaaaagaagttgaagagactgctacagctaagaatgttctgaaactcctttctgatttcttagatagtgaggtatctgaacttaggactggagctgcagaaggactagccaagctgatgttctctgggcttttggtcagcagcaggattctttctcgtcttattttgttatggtacaatcctgtgactgaagaggatgttcaacttcgacattgcctaggcgtgttcttccccgtgtttgcttatgcaagcaggactaatcaggaatgctttgaagaagcttttcttccaaccctgcaaacactggccaatgcccctgcatcttctcctttagctgaaattgatatcacaaatgttgctgagttacttgtagatttgacaagaccaagtggattaaatcctcaggccaagacttcccaagattatcaggccttaacagtacatgacaatttggctatgaaaatttgcaatgagatcttaacaagtccgtgctcgccagaaattcgagtctatacaaaagccttgagttctttagaactcagtagccatcttgcaaaagatcttctggttctattgaatgagattctggagcaagtaaaagataggacatgtctgagagctttggagaaaatcaagattcagttagaaaaaggaaataaagaatttggtgaccaagctgaagcagcacaggatgccaccttgactacaactactttccaaaatgaagatgaaaagaataaagaagtatatatgactccactcaggggtgtaaaagcaacccaagcatcaaagtctactcagctaaagactaacagaggacagagaaaagtgacagtttcagctaggacgaacaggaggtgtcagactgctgaagccgactctgaaagtgatcatgaagttccagaaccagaatcagaaatgaagatgagactaccaagacgagccaaaaccgcagcactagaaaaaagtaaacttaaccttgcccaatttctcaatgaagatctaagttag
Sequence Length
1308
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
114,334 Da
NCBI Official Full Name
Homo sapiens non-SMC condensin I complex, subunit G, mRNA
NCBI Official Synonym Full Names
non-SMC condensin I complex subunit G
NCBI Official Symbol
NCAPG
NCBI Official Synonym Symbols
CAPG; CHCG; YCG1; NY-MEL-3
NCBI Protein Information
condensin complex subunit 3
UniProt Protein Name
Condensin complex subunit 3
UniProt Gene Name
NCAPG
UniProt Synonym Gene Names
CAPG; NYMEL3; hCAP-G
UniProt Entry Name
CND3_HUMAN

NCBI Description

This gene encodes a subunit of the condensin complex, which is responsible for the condensation and stabilization of chromosomes during mitosis and meiosis. Phosphorylation of the encoded protein activates the condensin complex. There are pseudogenes for this gene on chromosomes 8 and 15. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Aug 2012]

Uniprot Description

NCAPG: Regulatory subunit of the condensin complex, a complex required for conversion of interphase chromatin into mitotic-like condense chromosomes. The condensin complex probably introduces positive supercoils into relaxed DNA in the presence of type I topoisomerases and converts nicked DNA into positive knotted forms in the presence of type II topoisomerases. Belongs to the CND3 (condensin subunit 3) family.

Protein type: Cell cycle regulation

Chromosomal Location of Human Ortholog: 4p15.33

Cellular Component: actin cytoskeleton; centrosome; condensin complex; cytoplasm; cytosol; membrane

Molecular Function: protein binding

Biological Process: mitotic chromosome condensation

Research Articles on NCAPG

Similar Products

Product Notes

The NCAPG ncapg (Catalog #AAA1270483) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgaatggaa tcatcgaatc tttgattctt cctggaataa taagtattca tcctgttgta agaaacctgg ctgttttatg cttgggatgc tgtggactac agaatcagga ttttgcaagg aaacacttcg tattactatt gcaggttttg caaattgatg atgtcacaat aaaaataagt gctttaaagg caatctttga ccaactgatg acgttcggga ttgaaccatt taaaactaaa aaaatcaaaa cacttcattg tgaaggtaca gaaataaaca gtgatgatga gcaagaatca aaagaagttg aagagactgc tacagctaag aatgttctga aactcctttc tgatttctta gatagtgagg tatctgaact taggactgga gctgcagaag gactagccaa gctgatgttc tctgggcttt tggtcagcag caggattctt tctcgtctta ttttgttatg gtacaatcct gtgactgaag aggatgttca acttcgacat tgcctaggcg tgttcttccc cgtgtttgct tatgcaagca ggactaatca ggaatgcttt gaagaagctt ttcttccaac cctgcaaaca ctggccaatg cccctgcatc ttctccttta gctgaaattg atatcacaaa tgttgctgag ttacttgtag atttgacaag accaagtgga ttaaatcctc aggccaagac ttcccaagat tatcaggcct taacagtaca tgacaatttg gctatgaaaa tttgcaatga gatcttaaca agtccgtgct cgccagaaat tcgagtctat acaaaagcct tgagttcttt agaactcagt agccatcttg caaaagatct tctggttcta ttgaatgaga ttctggagca agtaaaagat aggacatgtc tgagagcttt ggagaaaatc aagattcagt tagaaaaagg aaataaagaa tttggtgacc aagctgaagc agcacaggat gccaccttga ctacaactac tttccaaaat gaagatgaaa agaataaaga agtatatatg actccactca ggggtgtaaa agcaacccaa gcatcaaagt ctactcagct aaagactaac agaggacaga gaaaagtgac agtttcagct aggacgaaca ggaggtgtca gactgctgaa gccgactctg aaagtgatca tgaagttcca gaaccagaat cagaaatgaa gatgagacta ccaagacgag ccaaaaccgc agcactagaa aaaagtaaac ttaaccttgc ccaatttctc aatgaagatc taagttag. It is sometimes possible for the material contained within the vial of "NCAPG, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.