NAV1 cdna clone
NAV1 cDNA Clone
Gene Names
NAV1; POMFIL3; UNC53H1; STEERIN1
Synonyms
NAV1; NAV1 cDNA Clone; NAV1 cdna clone
Sequence
atgaagcttacagacatccgcttggaggccctcaactctgcccaccaactggatcagcttcgggagaccatgcacaacatgcagttggaggtggacctgctgaaagcagagaatgaccgactgaaggtagccccaggcccctcatcaggctccactccagggcaggtccctggatcatctgcattatcttccccacgccgctccctaggcctggcactcacccattccttcggccccagtcttgcagacacagacctgtcacccatggatggcatcagtacttgtggtccaaaggaggaagtgaccctccgggtggtggtgaggatgcccccgcagcacatcatcaaaggggacttgaagcagcaggaattcttcctgggctgtagcaaggtcagtggaaaagttgactggaagatgctggatgaagctgttttccaagtgttcaaggactatatttctaaaatggacccagcctctaccctgggactaagcactgagtccatccatggctacagcatcagccacgtgaaacgagtgttggatgcagagccccccgagatgcctccttgccgtcgaggtgtcaataacatatcagtctccctcaaaggtctgaaggagaaatgcgtcgacagcctggtgttcgagacgctgatccccaagccgatgatgcagcactacataagcctcctgctgaagcaccggcgcctcgtcctctcgggccccagcggcacgggcaagacctacctgaccaatcgcttggccgagtacctggtggagcgctctggccgtgaggtcacagagggcatcgtcagcaccttcaacatgcaccagcagtcttgcaaggatctgcaactgtatctttccaacctagccaaccagatagaccgggaaacaggaattggggatgtgcccctggtgattctattggatgacctgagtgaagcaggctccatcagtgagttggtcaatggggccctcacctgcaagtatcataaatgtccctatattataggtaccaccaatcagcctgtaaaaatgacacccaaccatggcttgcacttgagcttcaggatgttgaccttctccaacaacgtggagccagccaatggcttcctggttcgttacctgaggaggaagctggtagagtcagacagcgacatcaatgccaacaaggaagagctgcttcgggtgctcgactgggtacccaagctgtggtatcatctccacaccttccttgagaagcacagcacctcagacttcctcatcggcccttgcttctttctgtcgtgtcccattggcattgaggacttccggacctggttcattgacctgtggaacaactctatcattccctatctacaggaaggagccaaggatgggataaaggtccatggacagaaagctgcttgggaggacccagtggaatgggtccgggacacacttccctggccatcagcccaacaagaccaatcaaagctgtaccacctgcccccacccaccgtgggccctcacagcattgcctcacctcccgaggataggacagtcaaagacagcaccccaagttctctggactcagatcctctgatggccatgctgctgaaacttcaagaagctgccaactacattgagtctccagatcgagaaaccatcctggaccccaaccttcaggcaacactttaa
Sequence Length
1680
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment
NCBI and Uniprot Product Information
NCBI GI #
NCBI GeneID
Molecular Weight
195,040 Da
NCBI Official Full Name
Homo sapiens neuron navigator 1, mRNA
NCBI Official Synonym Full Names
neuron navigator 1
NCBI Official Symbol
NAV1
NCBI Official Synonym Symbols
POMFIL3; UNC53H1; STEERIN1
NCBI Protein Information
neuron navigator 1
UniProt Protein Name
Neuron navigator 1
Protein Family
UniProt Gene Name
NAV1
UniProt Synonym Gene Names
KIAA1151; KIAA1213; POMFIL3; STEERIN1; unc53H1
UniProt Entry Name
NAV1_HUMAN
NCBI Description
This gene belongs to the neuron navigator family and is expressed predominantly in the nervous system. The encoded protein contains coiled-coil domains and a conserved AAA domain characteristic for ATPases associated with a variety of cellular activities. This gene is similar to unc-53, a Caenorhabditis elegans gene involved in axon guidance. The exact function of this gene is not known, but it is thought to play a role in in neuronal development and regeneration. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Nov 2009]
Uniprot Description
NAV1: May be involved in neuronal migration. Belongs to the Nav/unc-53 family. 7 isoforms of the human protein are produced by alternative splicing.
Protein type: Cytoskeletal; Motility/polarity/chemotaxis
Chromosomal Location of Human Ortholog: 1q32.3
Research Articles on NAV1
Similar Products
Product Notes
The NAV1 nav1 (Catalog #AAA1273219) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgaagctta cagacatccg cttggaggcc ctcaactctg cccaccaact ggatcagctt cgggagacca tgcacaacat gcagttggag gtggacctgc tgaaagcaga gaatgaccga ctgaaggtag ccccaggccc ctcatcaggc tccactccag ggcaggtccc tggatcatct gcattatctt ccccacgccg ctccctaggc ctggcactca cccattcctt cggccccagt cttgcagaca cagacctgtc acccatggat ggcatcagta cttgtggtcc aaaggaggaa gtgaccctcc gggtggtggt gaggatgccc ccgcagcaca tcatcaaagg ggacttgaag cagcaggaat tcttcctggg ctgtagcaag gtcagtggaa aagttgactg gaagatgctg gatgaagctg ttttccaagt gttcaaggac tatatttcta aaatggaccc agcctctacc ctgggactaa gcactgagtc catccatggc tacagcatca gccacgtgaa acgagtgttg gatgcagagc cccccgagat gcctccttgc cgtcgaggtg tcaataacat atcagtctcc ctcaaaggtc tgaaggagaa atgcgtcgac agcctggtgt tcgagacgct gatccccaag ccgatgatgc agcactacat aagcctcctg ctgaagcacc ggcgcctcgt cctctcgggc cccagcggca cgggcaagac ctacctgacc aatcgcttgg ccgagtacct ggtggagcgc tctggccgtg aggtcacaga gggcatcgtc agcaccttca acatgcacca gcagtcttgc aaggatctgc aactgtatct ttccaaccta gccaaccaga tagaccggga aacaggaatt ggggatgtgc ccctggtgat tctattggat gacctgagtg aagcaggctc catcagtgag ttggtcaatg gggccctcac ctgcaagtat cataaatgtc cctatattat aggtaccacc aatcagcctg taaaaatgac acccaaccat ggcttgcact tgagcttcag gatgttgacc ttctccaaca acgtggagcc agccaatggc ttcctggttc gttacctgag gaggaagctg gtagagtcag acagcgacat caatgccaac aaggaagagc tgcttcgggt gctcgactgg gtacccaagc tgtggtatca tctccacacc ttccttgaga agcacagcac ctcagacttc ctcatcggcc cttgcttctt tctgtcgtgt cccattggca ttgaggactt ccggacctgg ttcattgacc tgtggaacaa ctctatcatt ccctatctac aggaaggagc caaggatggg ataaaggtcc atggacagaa agctgcttgg gaggacccag tggaatgggt ccgggacaca cttccctggc catcagccca acaagaccaa tcaaagctgt accacctgcc cccacccacc gtgggccctc acagcattgc ctcacctccc gaggatagga cagtcaaaga cagcacccca agttctctgg actcagatcc tctgatggcc atgctgctga aacttcaaga agctgccaac tacattgagt ctccagatcg agaaaccatc ctggacccca accttcaggc aacactttaa. It is sometimes possible for the material contained within the vial of "NAV1, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.Precautions
All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.Disclaimer
Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.Item has been added to Shopping Cart
If you are ready to order, navigate to Shopping Cart and get ready to checkout.
