Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

NAPA cdna clone

NAPA cDNA Clone

Gene Names
NAPA; SNAPA
Synonyms
NAPA; NAPA cDNA Clone; NAPA cdna clone
Ordering
For Research Use Only!
Sequence
atggacaattccgggaaggaagcggaggcgatggcgctgttggccgaggcggagcgcaaagtgaagaactcgcagtccttcttctctggcctctttggaggctcatccaaaatagaggaagcatgcgaaatctacgccagagcagcaaacatgttcaaaatggccaaaaactggagtgctgctggaaacgcgttctgccaggctgcacagctgcacctgcagctccagagcaagcacgacgcagccacctgctttgtggacgctggcaacgcattcaagaaagccgacccccaagaggccattaactgtttgatgcgagcaatcgagatctacacagacatgggccgattcacgattgcggccaagcaccacatctccattgctgagatctatgagacagagttggtggacatcgagaaggccattgcccactacgagcagtctgcagactactacaaaggcgaggagtccaacagctcagccaacaagtgtctgctgaaggtggctggttacgctgcgctgctggagcagtatcagaaggccattgacatctacgaacaggtggggaccaatgccatggacagccccctcctcaagtacagcgccaaagactacttcttcaaggcggccctctgccacttctgcatcgacatgctcaacgccaagctggctgtccaaaagtatgaggagctgttcccagctttctctgattcccgggaatgcaagttgatgaaaaaattgctagaggcccacgaggagcagaatgtggacagctacaccgagtcggtgaaggaatacgactccatctcccggctggaccagtggctcaccaccatgctgctgcgcatcaagaagaccatccagggcgatgaggaggacctgcgctaa
Sequence Length
888
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
33,233 Da
NCBI Official Full Name
Homo sapiens N-ethylmaleimide-sensitive factor attachment protein, alpha, mRNA
NCBI Official Synonym Full Names
NSF attachment protein alpha
NCBI Official Symbol
NAPA
NCBI Official Synonym Symbols
SNAPA
NCBI Protein Information
alpha-soluble NSF attachment protein
UniProt Protein Name
Alpha-soluble NSF attachment protein
Protein Family
UniProt Gene Name
NAPA
UniProt Synonym Gene Names
SNAPA; SNAP-alpha
UniProt Entry Name
SNAA_HUMAN

NCBI Description

This gene encodes a member of the soluble NSF attachment protein (SNAP) family. SNAP proteins play a critical role in the docking and fusion of vesicles to target membranes as part of the 20S NSF-SNAP-SNARE complex. The encoded protein plays a role in the completion of membrane fusion by mediating the interaction of N-ethylmaleimide-sensitive factor (NSF) with the vesicle-associated and membrane-associated SNAP receptor (SNARE) complex, and stimulating the ATPase activity of NSF. Alternatively spliced transcript variants have been observed for this gene. [provided by RefSeq, Jun 2011]

Uniprot Description

SNAP-alpha: Required for vesicular transport between the endoplasmic reticulum and the Golgi apparatus. Belongs to the SNAP family.

Protein type: Vesicle

Chromosomal Location of Human Ortholog: 19q13.33

Cellular Component: cytosol; membrane; SNARE complex; vacuolar membrane

Molecular Function: protein binding; soluble NSF attachment protein activity; syntaxin binding

Biological Process: COPII coating of Golgi vesicle; ER to Golgi vesicle-mediated transport; intra-Golgi vesicle-mediated transport; intracellular protein transport; retrograde vesicle-mediated transport, Golgi to ER

Research Articles on NAPA

Similar Products

Product Notes

The NAPA napa (Catalog #AAA1265930) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggacaatt ccgggaagga agcggaggcg atggcgctgt tggccgaggc ggagcgcaaa gtgaagaact cgcagtcctt cttctctggc ctctttggag gctcatccaa aatagaggaa gcatgcgaaa tctacgccag agcagcaaac atgttcaaaa tggccaaaaa ctggagtgct gctggaaacg cgttctgcca ggctgcacag ctgcacctgc agctccagag caagcacgac gcagccacct gctttgtgga cgctggcaac gcattcaaga aagccgaccc ccaagaggcc attaactgtt tgatgcgagc aatcgagatc tacacagaca tgggccgatt cacgattgcg gccaagcacc acatctccat tgctgagatc tatgagacag agttggtgga catcgagaag gccattgccc actacgagca gtctgcagac tactacaaag gcgaggagtc caacagctca gccaacaagt gtctgctgaa ggtggctggt tacgctgcgc tgctggagca gtatcagaag gccattgaca tctacgaaca ggtggggacc aatgccatgg acagccccct cctcaagtac agcgccaaag actacttctt caaggcggcc ctctgccact tctgcatcga catgctcaac gccaagctgg ctgtccaaaa gtatgaggag ctgttcccag ctttctctga ttcccgggaa tgcaagttga tgaaaaaatt gctagaggcc cacgaggagc agaatgtgga cagctacacc gagtcggtga aggaatacga ctccatctcc cggctggacc agtggctcac caccatgctg ctgcgcatca agaagaccat ccagggcgat gaggaggacc tgcgctaa. It is sometimes possible for the material contained within the vial of "NAPA, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.