Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

NALCN cdna clone

NALCN cDNA Clone

Gene Names
NALCN; IHPRF; INNFD; CanIon; IHPRF1; VGCNL1; CLIFAHDD; bA430M15.1
Synonyms
NALCN; NALCN cDNA Clone; NALCN cdna clone
Ordering
For Research Use Only!
Sequence
atgctcaaaaggaagcagagttccagggtggaagcccagccagtcactgactttggtcctgatgagtctctgtcggataatgctgacatcctctggattaacaaaccatgggttcactctttgctgcgcatctgtgccatcatcagcgtcatttctgtttgtatgaatacgccaatgaccttcgagcactatcctccacttcagtatgtgaccttcactttggatacattattgatgtttctctacacggcagagatgatagcaaaaatgcacatccggggcattgtcaagggggatagttcctatgtgaaagatcgctggtgtgtttttgatggatttatggtcttttgcctttgggtttctttggtgctacaggtgtttgaaattgctgatatagttgatcagatgtcaccttggggcatgttgcggattccacggccactgattatgatccgagcattccggatttatttccgatttgaactgccaaggaccagaattacaaatattttaaagcgatcgggagaacaaatatggagtgtttccatttttctacttttctttctacttctttatggaattttaggagttcagatgtttggaacatttacttatcactgtgttgtaaatgacacaaagccagggaatgtaacctggaatagtttagctattccagacacacactgctcaccagagctagaagaaggctaccagtgcccacctggatttaaatgcatggaccttgaagatctgggacttagcaggcaagagctgggctacagtggctttaatgagataggaactagtatattcaccgtctatgaggccgcctcacaggaaggctgggtgttcctcatgtacagagcaattgacagctttccccgttggcgttcctacttctatttcatcactctcattttcttcctcgcctggcttgtgaagaacgtgtttattgctgttatcattgaaacatttgcagaaatcagagtacagtttcaacaaatgtggggatcgagaagcagcactacctcaacagccaccacccagatgtttcatgaagatgctgctggaggttggcagctggtagctgtggatgtcaacaagccccagggacgcgccccagcctgcctccagaaaatgatgcggtcatccgttttccacatgttcatcctgagcatggtgaccgtggacgtgatcgtggcggctagcaactactacaaaggagaaaacttcaggaggcagtacgacgagttctacctggcggaggtggcttttacagtactttttgatttggaagcacttctgaagatatggtgtttgggatttactggatatattagctcatctctccacaaattcgaactactactcgtaattggaactactcttcatgtatacccagatctttatcattcacaattcacgtactttcaggttctccgagtagttcggctgattaagatttcacctgcattagaagactttgtgtacaagatatttggtcctggaaaaaagcttgggagtttggttgtatttactgccagcctcttgattgttatgtcagcaattagtttgcagatgttctgctttgttgaagaactggacagatttactacgtttccgagggcatttatgtccatgttccagatcctcacccaggaaggatgggtggacgtaatggaccaaactctaaatgctgtgggacatatgtgggcacccgtggttgccatctatttcattctctatcatctttttgccactctgcctccctctcttatccgtgacctctgtggcactcaagacgcctgtccatcctgccttcctctccagcctccaaaccatctgcctggaagccagactctggccagacttactcaccaggccctcaccacaccacctggaatgcgttcctcacagctcttttccaaaatcagtcttctccttggcatctgcgtggcttgggagagcatccttggctctctgtcattgtctcacaatcttcaataa
Sequence Length
2007
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
25,365 Da
NCBI Official Full Name
Homo sapiens sodium leak channel, non-selective, mRNA
NCBI Official Synonym Full Names
sodium leak channel, non-selective
NCBI Official Symbol
NALCN
NCBI Official Synonym Symbols
IHPRF; INNFD; CanIon; IHPRF1; VGCNL1; CLIFAHDD; bA430M15.1
NCBI Protein Information
sodium leak channel non-selective protein
UniProt Protein Name
Sodium leak channel non-selective protein
UniProt Gene Name
NALCN
UniProt Synonym Gene Names
VGCNL1
UniProt Entry Name
NALCN_HUMAN

NCBI Description

NALCN forms a voltage-independent, nonselective, noninactivating cation channel permeable to Na+, K+, and Ca(2+). It is responsible for the neuronal background sodium leak conductance (Lu et al., 2007 [PubMed 17448995]).[supplied by OMIM, Mar 2008]

Uniprot Description

VGCNL1: a putative voltage-gated ion channel

Protein type: Membrane protein, integral; Transporter, ion channel; Membrane protein, multi-pass; Channel, calcium

Chromosomal Location of Human Ortholog: 13q32.3

Cellular Component: plasma membrane

Molecular Function: cation channel activity; leak channel activity; protein binding; sodium channel activity

Biological Process: calcium ion transport; regulation of resting membrane potential

Disease: Congenital Contractures Of The Limbs And Face, Hypotonia, And Developmental Delay; Hypotonia, Infantile, With Psychomotor Retardation And Characteristic Facies

Research Articles on NALCN

Similar Products

Product Notes

The NALCN nalcn (Catalog #AAA1265832) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgctcaaaa ggaagcagag ttccagggtg gaagcccagc cagtcactga ctttggtcct gatgagtctc tgtcggataa tgctgacatc ctctggatta acaaaccatg ggttcactct ttgctgcgca tctgtgccat catcagcgtc atttctgttt gtatgaatac gccaatgacc ttcgagcact atcctccact tcagtatgtg accttcactt tggatacatt attgatgttt ctctacacgg cagagatgat agcaaaaatg cacatccggg gcattgtcaa gggggatagt tcctatgtga aagatcgctg gtgtgttttt gatggattta tggtcttttg cctttgggtt tctttggtgc tacaggtgtt tgaaattgct gatatagttg atcagatgtc accttggggc atgttgcgga ttccacggcc actgattatg atccgagcat tccggattta tttccgattt gaactgccaa ggaccagaat tacaaatatt ttaaagcgat cgggagaaca aatatggagt gtttccattt ttctactttt ctttctactt ctttatggaa ttttaggagt tcagatgttt ggaacattta cttatcactg tgttgtaaat gacacaaagc cagggaatgt aacctggaat agtttagcta ttccagacac acactgctca ccagagctag aagaaggcta ccagtgccca cctggattta aatgcatgga ccttgaagat ctgggactta gcaggcaaga gctgggctac agtggcttta atgagatagg aactagtata ttcaccgtct atgaggccgc ctcacaggaa ggctgggtgt tcctcatgta cagagcaatt gacagctttc cccgttggcg ttcctacttc tatttcatca ctctcatttt cttcctcgcc tggcttgtga agaacgtgtt tattgctgtt atcattgaaa catttgcaga aatcagagta cagtttcaac aaatgtgggg atcgagaagc agcactacct caacagccac cacccagatg tttcatgaag atgctgctgg aggttggcag ctggtagctg tggatgtcaa caagccccag ggacgcgccc cagcctgcct ccagaaaatg atgcggtcat ccgttttcca catgttcatc ctgagcatgg tgaccgtgga cgtgatcgtg gcggctagca actactacaa aggagaaaac ttcaggaggc agtacgacga gttctacctg gcggaggtgg cttttacagt actttttgat ttggaagcac ttctgaagat atggtgtttg ggatttactg gatatattag ctcatctctc cacaaattcg aactactact cgtaattgga actactcttc atgtataccc agatctttat cattcacaat tcacgtactt tcaggttctc cgagtagttc ggctgattaa gatttcacct gcattagaag actttgtgta caagatattt ggtcctggaa aaaagcttgg gagtttggtt gtatttactg ccagcctctt gattgttatg tcagcaatta gtttgcagat gttctgcttt gttgaagaac tggacagatt tactacgttt ccgagggcat ttatgtccat gttccagatc ctcacccagg aaggatgggt ggacgtaatg gaccaaactc taaatgctgt gggacatatg tgggcacccg tggttgccat ctatttcatt ctctatcatc tttttgccac tctgcctccc tctcttatcc gtgacctctg tggcactcaa gacgcctgtc catcctgcct tcctctccag cctccaaacc atctgcctgg aagccagact ctggccagac ttactcacca ggccctcacc acaccacctg gaatgcgttc ctcacagctc ttttccaaaa tcagtcttct ccttggcatc tgcgtggctt gggagagcat ccttggctct ctgtcattgt ctcacaatct tcaataa. It is sometimes possible for the material contained within the vial of "NALCN, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.