Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

NAE1 cdna clone

NAE1 cDNA Clone

Gene Names
NAE1; HPP1; ula-1; APPBP1; A-116A10.1
Synonyms
NAE1; NAE1 cDNA Clone; NAE1 cdna clone
Ordering
For Research Use Only!
Sequence
atggcgcagctgggaaagctgctcaaggagcagaagtacgaccggcagctgaggttgtggggtgatcatgggcaagaggctttagaatctgctcatgtttgcctaataaatgcaacagccacaggaactgaaattcttaaaaacttggtactaccaggtattggttcgtttacaattattgatggaaatcaggtcagcggagaagatgctggaaacaatttcttccttcaaagaagcagtatcggcaagaaccgagctgaagctgccatggaattcttacaagaattaaatagcgatgtctctggaagttttgtggaagagagtccagaaaaccttctagacaatgatccctcatttttctgtaggtttactgttgtagttgcaactcagcttcctgaaagcacttcactacgcttagcagatgtcctctggaattcccagattcctcttttgatctgtaggacatatggactagttggttatatgaggatcattataaaagaacatccagtaatagaatctcatccagataatgcattagaggatctacgactagataagccatttcctgaactgagagaacattttcagtcctatgatttggatcatatggaaaaaaaggaccacagtcatactccatggattgtgatcatagctaaatatttagcacagtggtatagtgaaacaaatggacgaatacctaaaacgtataaagaaaaagaggacttcagagatttgattagacaaggaattctaaaaaatgaaaatggggctccagaagatgaagagaattttgaagaagctattaaaaatgtgaacacagcactaaatacaactcagatcccaagcagtattgaagatatatttaatgatgatcgctgcataaatatcaccaaacagactccatcattttggattttagctcgtgccttaaaggaatttgtggccaaagagggtcaaggaaatttacctgttcgaggcacaattcctgatatgattgcagattcaggcaaatatataaaactgcaaaacgtttaccgtgaaaaagcaaagaaagatgctgccgctgtgggtaatcatgttgccaaattgctgcagtccattggccaggcaccagagtccatttcagagaaagaattaaaattactctgcagcaattctgcatttcttcgagtggtaagatgtcgatccttagctgaagaatatggtttggatacaattaacaaggatgaaattatttctagcatggacaatccagataatgaaatagtgttgtacttaatgttacgggctgttgatagatttcataaacaacagggtagatatccaggagtatctaactatcaagttgaagaagatataggaaagttgaagtcttgtctcactggcttccttcaggaatatggtttatctgtaatggtgaaagatgattatgtccacgaattttgccgatatggagctgctgagccacataccattgctgcattcttggggggagctgctgctcaagaggtcatcaaaataatcaccaaacaatttgtaatttttaataatacttacatttacagtggcatgtcacaaacttcagcaactttccagttgtag
Sequence Length
1605
Vector
pENTR223.1
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
60,517 Da
NCBI Official Full Name
Homo sapiens NEDD8 activating enzyme E1 subunit 1, mRNA
NCBI Official Synonym Full Names
NEDD8 activating enzyme E1 subunit 1
NCBI Official Symbol
NAE1
NCBI Official Synonym Symbols
HPP1; ula-1; APPBP1; A-116A10.1
NCBI Protein Information
NEDD8-activating enzyme E1 regulatory subunit
UniProt Protein Name
NEDD8-activating enzyme E1 regulatory subunit
UniProt Gene Name
NAE1
UniProt Synonym Gene Names
APPBP1; APP-BP1
UniProt Entry Name
ULA1_HUMAN

NCBI Description

The protein encoded by this gene binds to the beta-amyloid precursor protein. Beta-amyloid precursor protein is a cell surface protein with signal-transducing properties, and it is thought to play a role in the pathogenesis of Alzheimer's disease. In addition, the encoded protein can form a heterodimer with UBE1C and bind and activate NEDD8, a ubiquitin-like protein. This protein is required for cell cycle progression through the S/M checkpoint. Three transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]

Uniprot Description

APPBP1: Regulatory subunit of the dimeric UBA3-NAE1 E1 enzyme. E1 activates NEDD8 by first adenylating its C-terminal glycine residue with ATP, thereafter linking this residue to the side chain of the catalytic cysteine, yielding a NEDD8-UBA3 thioester and free AMP. E1 finally transfers NEDD8 to the catalytic cysteine of UBE2M. Necessary for cell cycle progression through the S-M checkpoint. Overexpression of NAE1 causes apoptosis through deregulation of NEDD8 conjugation. Belongs to the ubiquitin-activating E1 family. ULA1 subfamily. 2 isoforms of the human protein are produced by alternative splicing.

Protein type: Ubiquitin conjugating system

Chromosomal Location of Human Ortholog: 16q22

Cellular Component: cytoplasm; cytosol; nucleus

Molecular Function: NEDD8 activating enzyme activity; protein binding; protein heterodimerization activity; ubiquitin protein ligase binding

Biological Process: mitotic cell cycle DNA replication checkpoint; neuron apoptosis; protein neddylation; regulation of apoptosis; regulation of neuron apoptosis; signal transduction

Research Articles on NAE1

Similar Products

Product Notes

The NAE1 nae1 (Catalog #AAA1270405) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggcgcagc tgggaaagct gctcaaggag cagaagtacg accggcagct gaggttgtgg ggtgatcatg ggcaagaggc tttagaatct gctcatgttt gcctaataaa tgcaacagcc acaggaactg aaattcttaa aaacttggta ctaccaggta ttggttcgtt tacaattatt gatggaaatc aggtcagcgg agaagatgct ggaaacaatt tcttccttca aagaagcagt atcggcaaga accgagctga agctgccatg gaattcttac aagaattaaa tagcgatgtc tctggaagtt ttgtggaaga gagtccagaa aaccttctag acaatgatcc ctcatttttc tgtaggttta ctgttgtagt tgcaactcag cttcctgaaa gcacttcact acgcttagca gatgtcctct ggaattccca gattcctctt ttgatctgta ggacatatgg actagttggt tatatgagga tcattataaa agaacatcca gtaatagaat ctcatccaga taatgcatta gaggatctac gactagataa gccatttcct gaactgagag aacattttca gtcctatgat ttggatcata tggaaaaaaa ggaccacagt catactccat ggattgtgat catagctaaa tatttagcac agtggtatag tgaaacaaat ggacgaatac ctaaaacgta taaagaaaaa gaggacttca gagatttgat tagacaagga attctaaaaa atgaaaatgg ggctccagaa gatgaagaga attttgaaga agctattaaa aatgtgaaca cagcactaaa tacaactcag atcccaagca gtattgaaga tatatttaat gatgatcgct gcataaatat caccaaacag actccatcat tttggatttt agctcgtgcc ttaaaggaat ttgtggccaa agagggtcaa ggaaatttac ctgttcgagg cacaattcct gatatgattg cagattcagg caaatatata aaactgcaaa acgtttaccg tgaaaaagca aagaaagatg ctgccgctgt gggtaatcat gttgccaaat tgctgcagtc cattggccag gcaccagagt ccatttcaga gaaagaatta aaattactct gcagcaattc tgcatttctt cgagtggtaa gatgtcgatc cttagctgaa gaatatggtt tggatacaat taacaaggat gaaattattt ctagcatgga caatccagat aatgaaatag tgttgtactt aatgttacgg gctgttgata gatttcataa acaacagggt agatatccag gagtatctaa ctatcaagtt gaagaagata taggaaagtt gaagtcttgt ctcactggct tccttcagga atatggttta tctgtaatgg tgaaagatga ttatgtccac gaattttgcc gatatggagc tgctgagcca cataccattg ctgcattctt ggggggagct gctgctcaag aggtcatcaa aataatcacc aaacaatttg taatttttaa taatacttac atttacagtg gcatgtcaca aacttcagca actttccagt tgtag. It is sometimes possible for the material contained within the vial of "NAE1, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.