MYLPF cdna clone
MYLPF cDNA Clone
Gene Names
MYLPF; MLC2B; MRLC2; MYL11; HUMMLC2B
Synonyms
MYLPF; MYLPF cDNA Clone; MYLPF cdna clone
Sequence
atggcacccaagagggccaagagaaggacagtagagggcggaagctccagcgtcttctccatgttcgaccagactcagatccaggagttcaaagaggccttcactgtgatcgaccagaaccgtgatggtattatagacaaggaggaccttcgggacaccttcgcagccatgggccgcctcaatgtgaagaatgaggagttggatgccatgatgaaggaagccagcggtcccatcaacttcaccgtcttcctgaccatgttcggggagaagctcaagggtgccgaccctgaggatgtgatcaccggagccttcaaggtcttggaccctgagggaaagggcaccatcaagaagaagttcctggaggagctgctgaccacgcagtgtgaccgcttctcccaggaggagatcaagaacatgtgggcggccttcccccccgacgtgggcggcaacgtcgactacaaaaacatctgctacgtcatcacgcacggcgacgccaaggaccaggagtag
Sequence Length
510
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment
NCBI and Uniprot Product Information
NCBI GI #
NCBI GeneID
Molecular Weight
19,015 Da
NCBI Official Full Name
Homo sapiens myosin light chain, phosphorylatable, fast skeletal muscle, mRNA
NCBI Official Synonym Full Names
myosin light chain, phosphorylatable, fast skeletal muscle
NCBI Official Symbol
MYLPF
NCBI Official Synonym Symbols
MLC2B; MRLC2; MYL11; HUMMLC2B
NCBI Protein Information
myosin regulatory light chain 2, skeletal muscle isoform
UniProt Protein Name
Myosin regulatory light chain 2, skeletal muscle isoform
Protein Family
UniProt Gene Name
MYLPF
UniProt Entry Name
MLRS_HUMAN
Uniprot Description
MYLPF: Myosin is an hexamer of 2 heavy chains and 4 light chains.
Protein type: Motility/polarity/chemotaxis; Motor
Chromosomal Location of Human Ortholog: 16p11.2
Cellular Component: cytosol; lysosomal membrane; muscle myosin complex
Molecular Function: structural constituent of muscle
Biological Process: muscle contraction; skeletal muscle development
Research Articles on MYLPF
Similar Products
Product Notes
The MYLPF mylpf (Catalog #AAA1271830) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggcaccca agagggccaa gagaaggaca gtagagggcg gaagctccag cgtcttctcc atgttcgacc agactcagat ccaggagttc aaagaggcct tcactgtgat cgaccagaac cgtgatggta ttatagacaa ggaggacctt cgggacacct tcgcagccat gggccgcctc aatgtgaaga atgaggagtt ggatgccatg atgaaggaag ccagcggtcc catcaacttc accgtcttcc tgaccatgtt cggggagaag ctcaagggtg ccgaccctga ggatgtgatc accggagcct tcaaggtctt ggaccctgag ggaaagggca ccatcaagaa gaagttcctg gaggagctgc tgaccacgca gtgtgaccgc ttctcccagg aggagatcaa gaacatgtgg gcggccttcc cccccgacgt gggcggcaac gtcgactaca aaaacatctg ctacgtcatc acgcacggcg acgccaagga ccaggagtag. It is sometimes possible for the material contained within the vial of "MYLPF, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.Precautions
All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.Disclaimer
Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.Item has been added to Shopping Cart
If you are ready to order, navigate to Shopping Cart and get ready to checkout.
