MYLK4 cdna clone
MYLK4 cDNA Clone
Gene Names
MYLK4; SgK085
Synonyms
MYLK4; MYLK4 cDNA Clone; MYLK4 cdna clone
Sequence
atgttaaaagtgaagaggctggaagaattcaacacgtgttataacagcaaccagctggagaaaatggccttttttcagtgcagggaagaggtggagaaagtgaagtgttttctggaaaaaaattctggggaccaggattcaagatctagacataatgaggcgaaggaggtgtggtcaaacgccgacctgacggaaaggatgcccgtcaaaagcaaaaggacatcagccctcgcagttgacatcccggctcctccggccccatttgatcatcgtattgtgacagccaagcaaggagcggtcaacagcttctatactgtgagcaagacagaaatcctaggaggagggcgtttcggccaggttcacaagtgtgaggagacggccacaggtctgaagctggcagccaaaatcatcaagaccagaggcatgaaggacaaggaggaggtgaagaacgagatcagcgtcatgaaccagctggaccacgcgaacctcatccagctgtacgatgccttcgagtctaagaacgacattgtcctggtcatggagtatgtggatggtggggagctgtttgaccgcatcatcgatgagagctacaatttgacggagcttgataccatcctgttcatgaagcagatatgtgaggggataaggcacatgcatcagatgtacattctccacttggacctgaagcctgagaatatcctgtgtgtgaatcgggatgctaagcaaataaaaattattgattttggattggccagaagatacaaacccagagagaagctgaaggtgaactttggaaccccagaatttctcgcccctgaagttgtgaactatgattttgtttcatttcccactgacatgtggagtgtgggggtcatcgcctatatgctacttagcggtttgtcgcctttcctgggtgacaatgatgctgagacgctgaacaacatcctggcctgcaggtgggacttagaggatgaagaatttcaggacatctcggaggaggccaaggagttcatctctaagcttctgattaaggagaagagttggcgaataagtgcaagcgaagctctcaagcacccctggttgtcagaccacaagctccactccagactcaatgcccagaagaagaagaatcgtggctctgatgcccaggactttgtgaccaaatag
Sequence Length
1167
Vector
Please Inquire
NCBI and Uniprot Product Information
NCBI GI #
NCBI GeneID
Molecular Weight
44,487 Da
NCBI Official Full Name
Homo sapiens myosin light chain kinase family, member 4, mRNA
NCBI Official Synonym Full Names
myosin light chain kinase family member 4
NCBI Official Symbol
MYLK4
NCBI Official Synonym Symbols
SgK085
NCBI Protein Information
myosin light chain kinase family member 4
UniProt Protein Name
Myosin light chain kinase family member 4
Protein Family
UniProt Gene Name
MYLK4
UniProt Synonym Gene Names
SGK085; SgK085
UniProt Entry Name
MYLK4_HUMAN
Uniprot Description
MYLK4: Belongs to the protein kinase superfamily. CAMK Ser/Thr protein kinase family. 2 isoforms of the human protein are produced by alternative splicing.
Protein type: Protein kinase, Ser/Thr (non-receptor); Kinase, protein; EC 2.7.11.1; Protein kinase, CAMK; CAMK group; MLCK family
Chromosomal Location of Human Ortholog: 6p25.2
Research Articles on MYLK4
Similar Products
Product Notes
The MYLK4 mylk4 (Catalog #AAA1268445) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgttaaaag tgaagaggct ggaagaattc aacacgtgtt ataacagcaa ccagctggag aaaatggcct tttttcagtg cagggaagag gtggagaaag tgaagtgttt tctggaaaaa aattctgggg accaggattc aagatctaga cataatgagg cgaaggaggt gtggtcaaac gccgacctga cggaaaggat gcccgtcaaa agcaaaagga catcagccct cgcagttgac atcccggctc ctccggcccc atttgatcat cgtattgtga cagccaagca aggagcggtc aacagcttct atactgtgag caagacagaa atcctaggag gagggcgttt cggccaggtt cacaagtgtg aggagacggc cacaggtctg aagctggcag ccaaaatcat caagaccaga ggcatgaagg acaaggagga ggtgaagaac gagatcagcg tcatgaacca gctggaccac gcgaacctca tccagctgta cgatgccttc gagtctaaga acgacattgt cctggtcatg gagtatgtgg atggtgggga gctgtttgac cgcatcatcg atgagagcta caatttgacg gagcttgata ccatcctgtt catgaagcag atatgtgagg ggataaggca catgcatcag atgtacattc tccacttgga cctgaagcct gagaatatcc tgtgtgtgaa tcgggatgct aagcaaataa aaattattga ttttggattg gccagaagat acaaacccag agagaagctg aaggtgaact ttggaacccc agaatttctc gcccctgaag ttgtgaacta tgattttgtt tcatttccca ctgacatgtg gagtgtgggg gtcatcgcct atatgctact tagcggtttg tcgcctttcc tgggtgacaa tgatgctgag acgctgaaca acatcctggc ctgcaggtgg gacttagagg atgaagaatt tcaggacatc tcggaggagg ccaaggagtt catctctaag cttctgatta aggagaagag ttggcgaata agtgcaagcg aagctctcaa gcacccctgg ttgtcagacc acaagctcca ctccagactc aatgcccaga agaagaagaa tcgtggctct gatgcccagg actttgtgac caaatag. It is sometimes possible for the material contained within the vial of "MYLK4, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.Precautions
All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.Disclaimer
Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.Item has been added to Shopping Cart
If you are ready to order, navigate to Shopping Cart and get ready to checkout.
