Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

MYL6 cdna clone

MYL6 cDNA Clone

Gene Names
MYL6; LC17; ESMLC; LC17A; LC17B; MLC-3; MLC1SM; MLC3NM; MLC3SM; LC17-GI; LC17-NM
Synonyms
MYL6; MYL6 cDNA Clone; MYL6 cdna clone
Ordering
For Research Use Only!
Sequence
atgtgtgacttcaccgaagaccagaccgcagagttcaaggaggccttccagctgtttgaccgaacaggtgatggcaagatcctgtacagccagtgtggggatgtgatgagggccctgggccagaaccctaccaacgccgaggtgctcaaggtcctggggaaccccaagagtgatgagatgaatgtgaaggtgctggactttgagcactttctgcccatgctgcagacagtggccaagaacaaggaccagggcacctatgaggattatgtcgaaggacttcgggtgtttgacaaggaaggaaatggcaccgtcatgggtgctgaaatccggcatgttcttgtcacactgggtgagaagatgacagaggaagaagtagagatgctggtggcagggcatgaggacagcaatggttgtatcaactatgaagagctcgtccgcatggtgctgaatggctga
Sequence Length
456
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
16,961 Da
NCBI Official Full Name
Homo sapiens myosin, light chain 6, alkali, smooth muscle and non-muscle, mRNA
NCBI Official Synonym Full Names
myosin light chain 6
NCBI Official Symbol
MYL6
NCBI Official Synonym Symbols
LC17; ESMLC; LC17A; LC17B; MLC-3; MLC1SM; MLC3NM; MLC3SM; LC17-GI; LC17-NM
NCBI Protein Information
myosin light polypeptide 6
UniProt Protein Name
Myosin light polypeptide 6
Protein Family
UniProt Gene Name
MYL6
UniProt Synonym Gene Names
LC17; MLC-3; Myosin light chain A3
UniProt Entry Name
MYL6_HUMAN

NCBI Description

Myosin is a hexameric ATPase cellular motor protein. It is composed of two heavy chains, two nonphosphorylatable alkali light chains, and two phosphorylatable regulatory light chains. This gene encodes a myosin alkali light chain that is expressed in smooth muscle and non-muscle tissues. Genomic sequences representing several pseudogenes have been described and two transcript variants encoding different isoforms have been identified for this gene. [provided by RefSeq, Jul 2008]

Uniprot Description

MYL6: Regulatory light chain of myosin. Does not bind calcium. 2 isoforms of the human protein are produced by alternative splicing.

Protein type: Motor; Motility/polarity/chemotaxis

Chromosomal Location of Human Ortholog: 12q13.2

Cellular Component: brush border; cytosol; extracellular matrix; membrane; myosin complex; unconventional myosin complex; vesicle

Molecular Function: actin-dependent ATPase activity; motor activity; protein binding; structural constituent of muscle

Biological Process: muscle contraction; muscle filament sliding; skeletal muscle development

Similar Products

Product Notes

The MYL6 myl6 (Catalog #AAA1268972) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgtgtgact tcaccgaaga ccagaccgca gagttcaagg aggccttcca gctgtttgac cgaacaggtg atggcaagat cctgtacagc cagtgtgggg atgtgatgag ggccctgggc cagaacccta ccaacgccga ggtgctcaag gtcctgggga accccaagag tgatgagatg aatgtgaagg tgctggactt tgagcacttt ctgcccatgc tgcagacagt ggccaagaac aaggaccagg gcacctatga ggattatgtc gaaggacttc gggtgtttga caaggaagga aatggcaccg tcatgggtgc tgaaatccgg catgttcttg tcacactggg tgagaagatg acagaggaag aagtagagat gctggtggca gggcatgagg acagcaatgg ttgtatcaac tatgaagagc tcgtccgcat ggtgctgaat ggctga. It is sometimes possible for the material contained within the vial of "MYL6, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.