Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

MYL3 cdna clone

MYL3 cDNA Clone

Gene Names
MYL3; CMH8; VLC1; VLCl; MLC1V; MLC1SB; MLC-lV/sb
Synonyms
MYL3; MYL3 cDNA Clone; MYL3 cdna clone
Ordering
For Research Use Only!
Sequence
atggcccccaaaaagccagagcccaagaaggatgatgccaaggcagcccccaaggcagctccagctcccgcacctccccctgagcctgagcgccctaaggaggtcgagtttgatgcttccaagatcaagattgagttcacacctgagcagattgaagagttcaaggaagccttcatgctgttcgaccgcacacccaagtgtgagatgaagatcacctacgggcagtgtggggatgtcctgcgggcgctgggccagaaccccacacaggcagaagtgctccgtgtcctggggaagccaagacaggaagagctcaataccaagatgatggactttgaaactttcctgcctatgctccagcacatttccaagaacaaggacacaggcacctatgaggacttcgtggaggggctgcgggtcttcgacaaggagggcaatggcactgtcatgggtgctgagcttcgccacgtgctggccacgctgggtgagaggctgacagaagacgaagtggagaagttgatggctgggcaagaggactccaatggctgcatcaactatgaagcatttgtgaagcacatcatgtccagctaa
Sequence Length
588
Vector
pENTR223.1
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
21,932 Da
NCBI Official Full Name
Homo sapiens myosin, light chain 3, alkali; ventricular, skeletal, slow, mRNA
NCBI Official Synonym Full Names
myosin light chain 3
NCBI Official Symbol
MYL3
NCBI Official Synonym Symbols
CMH8; VLC1; VLCl; MLC1V; MLC1SB; MLC-lV/sb
NCBI Protein Information
myosin light chain 3
UniProt Protein Name
Myosin light chain 3
Protein Family
UniProt Gene Name
MYL3
UniProt Synonym Gene Names
MLC-lV/sb
UniProt Entry Name
MYL3_HUMAN

NCBI Description

MYL3 encodes myosin light chain 3, an alkali light chain also referred to in the literature as both the ventricular isoform and the slow skeletal muscle isoform. Mutations in MYL3 have been identified as a cause of mid-left ventricular chamber type hypertrophic cardiomyopathy. [provided by RefSeq, Jul 2008]

Uniprot Description

MYL3: Regulatory light chain of myosin. Does not bind calcium. Defects in MYL3 are the cause of familial hypertrophic cardiomyopathy type 8 (CMH8). Familial hypertrophic cardiomyopathy is a hereditary heart disorder characterized by ventricular hypertrophy, which is usually asymmetric and often involves the interventricular septum. The symptoms include dyspnea, syncope, collapse, palpitations, and chest pain. They can be readily provoked by exercise. The disorder has inter- and intrafamilial variability ranging from benign to malignant forms with high risk of cardiac failure and sudden cardiac death. CMH8 inheritance can be autosomal dominant or recessive.

Protein type: Motor; Motility/polarity/chemotaxis

Chromosomal Location of Human Ortholog: 3p21.3-p21.2

Cellular Component: A band; cytosol; I band; muscle myosin complex; sarcomere

Molecular Function: actin monomer binding; structural constituent of muscle

Biological Process: cardiac muscle contraction; muscle filament sliding; positive regulation of ATPase activity; regulation of striated muscle contraction; regulation of the force of heart contraction; ventricular cardiac muscle morphogenesis

Disease: Cardiomyopathy, Familial Hypertrophic, 8

Research Articles on MYL3

Similar Products

Product Notes

The MYL3 myl3 (Catalog #AAA1270981) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggccccca aaaagccaga gcccaagaag gatgatgcca aggcagcccc caaggcagct ccagctcccg cacctccccc tgagcctgag cgccctaagg aggtcgagtt tgatgcttcc aagatcaaga ttgagttcac acctgagcag attgaagagt tcaaggaagc cttcatgctg ttcgaccgca cacccaagtg tgagatgaag atcacctacg ggcagtgtgg ggatgtcctg cgggcgctgg gccagaaccc cacacaggca gaagtgctcc gtgtcctggg gaagccaaga caggaagagc tcaataccaa gatgatggac tttgaaactt tcctgcctat gctccagcac atttccaaga acaaggacac aggcacctat gaggacttcg tggaggggct gcgggtcttc gacaaggagg gcaatggcac tgtcatgggt gctgagcttc gccacgtgct ggccacgctg ggtgagaggc tgacagaaga cgaagtggag aagttgatgg ctgggcaaga ggactccaat ggctgcatca actatgaagc atttgtgaag cacatcatgt ccagctaa. It is sometimes possible for the material contained within the vial of "MYL3, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.