Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

MYCT1 cdna clone

MYCT1 cDNA Clone

Gene Names
MYCT1; MTLC
Synonyms
MYCT1; MYCT1 cDNA Clone; MYCT1 cdna clone
Ordering
For Research Use Only!
Sequence
ATGCGAACACAAGTATATGAGGGGTTGTGTAAAAATTATTTTTCTCTTGCTGTACTACAAAGAGATAGAATCAAACTGCTTTTTTTCGACATACTGGTTTTTCTTTCTGTTTTTCTTCTCTTTCTTCTATTTCTTGTGGATATTATGGCTAATAACACAACAAGTTTAGGGAGTCCATGGCCAGAAAACTTTTGGGAGGACCTTATCATGTCCTTCACTGTATCCATGGCAATCGGGCTGGTACTTGGAGGATTTATTTGGGCTGTGTTCATTTGTCTGTCTCGAAGAAGAAGAGCCAGTGCTCCCATCTCACAGTGGAGTTCAAGCAGGAGATCTAGGTCTTCTTACACCCACGGCCTCAACAGAACTGGATTTTACCGCCACAGTGGCTGTGAACGTCGAAGCAACCTCAGCCTGGCCAGTCTCACCTTCCAGCGACAAGCTTCCCTGGAACAAGCAAATTCCTTTCCAAGAAAATCAAGTTTCAGAGCTTCTACTTTCCATCCCTTTCTGCAATGTCCACCACTTCCTGTGGAAACTGAGAGTCAGCTGGTGACTCTCCCTTCTTCCAATATCTCTCCCACCATCAGCACTTCCCACAGTCTGAGCCGTCCTGACTACTGGTCCAGTAACAGTCTTCGAGTGGGCCTTTCAACACCGCCCCCACCTGCCTATGAGTCCATCATCAAGGCATTCCCAGATTCCTGA
Sequence Length
708
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
26,593 Da
NCBI Official Full Name
Homo sapiens myc target 1, mRNA
NCBI Official Synonym Full Names
myc target 1
NCBI Official Symbol
MYCT1
NCBI Official Synonym Symbols
MTLC
NCBI Protein Information
myc target protein 1
UniProt Protein Name
Myc target protein 1
Protein Family
UniProt Gene Name
MYCT1
UniProt Synonym Gene Names
MTLC; MTMC1
UniProt Entry Name
MYCT1_HUMAN

Uniprot Description

MYCT1: May regulate certain MYC target genes, MYC seems to be a direct upstream transcriptional activator. Does not seem to significantly affect growth cell capacity. Overexpression seems to mediate many of the known phenotypic features associated with MYC, including promotion of apoptosis, alteration of morphology, enhancement of anchorage-independent growth, tumorigenic conversion, promotion of genomic instability, and inhibition of hematopoietic differentiation. Belongs to the MYCT1 family.

Protein type: Membrane protein, integral

Chromosomal Location of Human Ortholog: 6q25.2

Research Articles on MYCT1

Similar Products

Product Notes

The MYCT1 myct1 (Catalog #AAA1274300) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: ATGCGAACAC AAGTATATGA GGGGTTGTGT AAAAATTATT TTTCTCTTGC TGTACTACAA AGAGATAGAA TCAAACTGCT TTTTTTCGAC ATACTGGTTT TTCTTTCTGT TTTTCTTCTC TTTCTTCTAT TTCTTGTGGA TATTATGGCT AATAACACAA CAAGTTTAGG GAGTCCATGG CCAGAAAACT TTTGGGAGGA CCTTATCATG TCCTTCACTG TATCCATGGC AATCGGGCTG GTACTTGGAG GATTTATTTG GGCTGTGTTC ATTTGTCTGT CTCGAAGAAG AAGAGCCAGT GCTCCCATCT CACAGTGGAG TTCAAGCAGG AGATCTAGGT CTTCTTACAC CCACGGCCTC AACAGAACTG GATTTTACCG CCACAGTGGC TGTGAACGTC GAAGCAACCT CAGCCTGGCC AGTCTCACCT TCCAGCGACA AGCTTCCCTG GAACAAGCAA ATTCCTTTCC AAGAAAATCA AGTTTCAGAG CTTCTACTTT CCATCCCTTT CTGCAATGTC CACCACTTCC TGTGGAAACT GAGAGTCAGC TGGTGACTCT CCCTTCTTCC AATATCTCTC CCACCATCAG CACTTCCCAC AGTCTGAGCC GTCCTGACTA CTGGTCCAGT AACAGTCTTC GAGTGGGCCT TTCAACACCG CCCCCACCTG CCTATGAGTC CATCATCAAG GCATTCCCAG ATTCCTGA. It is sometimes possible for the material contained within the vial of "MYCT1, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.