Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

MX2 cdna clone

MX2 cDNA Clone

Gene Names
MX2; MXB
Synonyms
MX2; MX2 cDNA Clone; MX2 cdna clone
Ordering
For Research Use Only!
Sequence
atgtctaaggcccacaagccttggccctaccggaggagaagtcaattttcttctcgaaaatacctgaaaaaagaaatgaattccttccagcaacagccaccgccattcggcacagtgccaccacaaatgatgtttcctccaaactggcagggggcagagaaggacgctgctttcctcgccaaggacttcaactttctcactttgaacaatcagccaccaccaggaaacaggagccaaccaagggcaatggggcccgagaacaacctgtacagccagtacgagcagaaggtgcgcccctgcattgacctcatcgactccctgcgggctctgggtgtggagcaggacctggccctgccagccatcgccgtcatcggggaccagagctcgggcaagagctctgtgctggaggcactgtcaggagtcgcgcttcccagaggcagcggaatcgtaaccaggtgtccgctggtgctgaaactgaaaaagcagccctgtgaggcatgggccggaaggatcagctaccggaacaccgagctagagcttcaggaccctggccaggtggagaaagagatacacaaagcccagaacgtcatggccgggaatggccggggcatcagccatgagctcatcagcctggagatcacctcccctgaggttccagacctgaccatcattgaccttcccggcatcaccagggtggctgtggacaaccagccccgagacatcggactgcagatcaaggctctcatcaagaagtacatccagaggcagcagacgatcaacttggtggtggttccctgtaacgtggacattgccaccacggaggcgctgagcatggcccatgaggtggacccggaaggggacaggaccatcggtatcctgaccaaaccagatctaatggacaggggcactgagaaaagcgtcatgaatgtggtgcggaacctcacgtaccccctcaagaagggctacatgattgtgaagtgccggggccagcaggagatcacaaacaggctgagcttggcagaggcaaccaagaaagaaattacattctttcaaacacatccatatttcagagttctcctggaggaggggtcagccacggttccccgactggcagaaagacttaccactgaactcatcatgcatatccaaaaatcgctcccgttgttagaaggacaaataagggagagccaccagaaggcgaccgaggagctgcggcgttgcggggctgacatccccagccaggaggccgacaagatgttctttctaattgagaaaatcaagatgtttaatcaggacatcgaaaagttagtagaaggagaagaagttgtaagggagaatgagacccgtttatacaacaaaatcagagaggattttaaaaactgggtaggcatacttgcaactaatacccaaaaagttaaaaatattatccacgaagaagttgaaaaatatgaaaagcagtatcgaggcaaggagcttctgggatttgtcaactacaagacatttgagatcatcgtgcatcagtacatccagcagctggtggagcccgcccttagcatgctccagaaagccatggaaattatccagcaagctttcattaacgtggccaaaaaacattttggcgaatttttcaaccttaaccaaactgttcagagcacgattgaagacataaaagtgaaacacacagcaaaggcagaaaacatgatccaacttcagttcagaatggagcagatggttttttgtcaagatcagatttacagtgttgttctgaagaaagtccgagaagagatttttaaccctctggggacgccttcacagaatatgaagttgaactctcattttcccagtaatgagtcttcggtttcctcctttactgaaataggcatccacctgaatgcctacttcttggaaaccagcaaacgtctcgccaaccagatcccatttataattcagtattttatgctccgagagaatggtgactccttgcagaaagccatgatgcagatactacaggaaaaaaatcgctattcctggctgcttcaagagcagagtgagaccgctaccaagagaagaatccttaaggagagaatttaccggctcactcaggcgcgacacgcactctgtcaattctccagcaaagagatccactga
Sequence Length
2148
Vector
Please Inquire

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
22,105 Da
NCBI Official Full Name
Homo sapiens myxovirus (influenza virus) resistance 2 (mouse), mRNA
NCBI Official Synonym Full Names
MX dynamin like GTPase 2
NCBI Official Symbol
MX2
NCBI Official Synonym Symbols
MXB
NCBI Protein Information
interferon-induced GTP-binding protein Mx2
UniProt Protein Name
Interferon-induced GTP-binding protein Mx2
UniProt Gene Name
MX2
UniProt Entry Name
MX2_HUMAN

NCBI Description

The protein encoded by this gene has a nuclear and a cytoplasmic form and is a member of both the dynamin family and the family of large GTPases. The nuclear form is localized in a granular pattern in the heterochromatin region beneath the nuclear envelope. A nuclear localization signal (NLS) is present at the amino terminal end of the nuclear form but is lacking in the cytoplasmic form due to use of an alternate translation start codon. This protein is upregulated by interferon-alpha but does not contain the antiviral activity of a similar myxovirus resistance protein 1. [provided by RefSeq, Jul 2008]

Uniprot Description

MX2: has a nuclear and a cytoplasmic form and is a member of both the dynamin family and the family of large GTPases. The nuclear form is localized in a granular pattern in the heterochromatin region beneath the nuclear envelope. A nuclear localization signal (NLS) is present at the amino terminal end of the nuclear form but is lacking in the cytoplasmic form due to use of an alternate translation start codon. This protein is upregulated by interferon-alpha but does not contain the antiviral activity of a similar myxovirus resistance protein 1. [provided by RefSeq, Jul 2008]

Protein type: G protein regulator, misc.

Chromosomal Location of Human Ortholog: 21q22.3

Cellular Component: cytoplasm; cytosol; nuclear pore; nucleus

Molecular Function: GTP binding; protein binding

Biological Process: defense response; defense response to virus; regulation of cell cycle; regulation of nucleocytoplasmic transport; response to virus

Research Articles on MX2

Similar Products

Product Notes

The MX2 mx2 (Catalog #AAA1275298) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgtctaagg cccacaagcc ttggccctac cggaggagaa gtcaattttc ttctcgaaaa tacctgaaaa aagaaatgaa ttccttccag caacagccac cgccattcgg cacagtgcca ccacaaatga tgtttcctcc aaactggcag ggggcagaga aggacgctgc tttcctcgcc aaggacttca actttctcac tttgaacaat cagccaccac caggaaacag gagccaacca agggcaatgg ggcccgagaa caacctgtac agccagtacg agcagaaggt gcgcccctgc attgacctca tcgactccct gcgggctctg ggtgtggagc aggacctggc cctgccagcc atcgccgtca tcggggacca gagctcgggc aagagctctg tgctggaggc actgtcagga gtcgcgcttc ccagaggcag cggaatcgta accaggtgtc cgctggtgct gaaactgaaa aagcagccct gtgaggcatg ggccggaagg atcagctacc ggaacaccga gctagagctt caggaccctg gccaggtgga gaaagagata cacaaagccc agaacgtcat ggccgggaat ggccggggca tcagccatga gctcatcagc ctggagatca cctcccctga ggttccagac ctgaccatca ttgaccttcc cggcatcacc agggtggctg tggacaacca gccccgagac atcggactgc agatcaaggc tctcatcaag aagtacatcc agaggcagca gacgatcaac ttggtggtgg ttccctgtaa cgtggacatt gccaccacgg aggcgctgag catggcccat gaggtggacc cggaagggga caggaccatc ggtatcctga ccaaaccaga tctaatggac aggggcactg agaaaagcgt catgaatgtg gtgcggaacc tcacgtaccc cctcaagaag ggctacatga ttgtgaagtg ccggggccag caggagatca caaacaggct gagcttggca gaggcaacca agaaagaaat tacattcttt caaacacatc catatttcag agttctcctg gaggaggggt cagccacggt tccccgactg gcagaaagac ttaccactga actcatcatg catatccaaa aatcgctccc gttgttagaa ggacaaataa gggagagcca ccagaaggcg accgaggagc tgcggcgttg cggggctgac atccccagcc aggaggccga caagatgttc tttctaattg agaaaatcaa gatgtttaat caggacatcg aaaagttagt agaaggagaa gaagttgtaa gggagaatga gacccgttta tacaacaaaa tcagagagga ttttaaaaac tgggtaggca tacttgcaac taatacccaa aaagttaaaa atattatcca cgaagaagtt gaaaaatatg aaaagcagta tcgaggcaag gagcttctgg gatttgtcaa ctacaagaca tttgagatca tcgtgcatca gtacatccag cagctggtgg agcccgccct tagcatgctc cagaaagcca tggaaattat ccagcaagct ttcattaacg tggccaaaaa acattttggc gaatttttca accttaacca aactgttcag agcacgattg aagacataaa agtgaaacac acagcaaagg cagaaaacat gatccaactt cagttcagaa tggagcagat ggttttttgt caagatcaga tttacagtgt tgttctgaag aaagtccgag aagagatttt taaccctctg gggacgcctt cacagaatat gaagttgaac tctcattttc ccagtaatga gtcttcggtt tcctccttta ctgaaatagg catccacctg aatgcctact tcttggaaac cagcaaacgt ctcgccaacc agatcccatt tataattcag tattttatgc tccgagagaa tggtgactcc ttgcagaaag ccatgatgca gatactacag gaaaaaaatc gctattcctg gctgcttcaa gagcagagtg agaccgctac caagagaaga atccttaagg agagaattta ccggctcact caggcgcgac acgcactctg tcaattctcc agcaaagaga tccactga. It is sometimes possible for the material contained within the vial of "MX2, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.