Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

MX1 cdna clone

MX1 cDNA Clone

Gene Names
MX1; MX; MxA; IFI78; IFI-78K
Synonyms
MX1; MX1 cDNA Clone; MX1 cdna clone
Ordering
For Research Use Only!
Sequence
atggttgtttccgaagtggacatcgcaaaagctgatccagctgctgcatcccaccctctattactgaatggagatgctactgtggcccagaaaaatccaggctcggtggctgagaacaacctgtgcagccagtatgaggagaaggtgcgcccctgcatcgacctcattgactccctgcgggctctaggtgtggagcaggacctggccctgccagccatcgccgtcatcggggaccagagctcgggcaagagctccgtgttggaggcactgtcaggagttgcccttcccagaggcagcgggatcgtgaccagatgcccgctggtgctgaaactgaagaaacttgtgaacgaagataagtggagaggcaaggtcagttaccaggactacgagattgagatttcggatgcttcagaggtagaaaaggaaattaataaagcccagaatgccatcgccggggaaggaatgggaatcagtcatgagctaatcaccctggagatcagctcccgagatgtcccggatctgactctaatagaccttcctggcataaccagagtggctgtgggcaatcagcctgctgacattgggtataagatcaagacactcatcaagaagtacatccagaggcaggagacaatcagcctggtggtggtccccagtaatgtggacattgccaccacagaggctctcagcatggcccaggaggtggaccccgagggagacaggaccatcggaatcttgacgaagcctgatctggtggacaaaggaactgaagacaaggttgtggacgtggtgcggaacctcgtgttccacctgaagaagggttacatgattgtcaagtgccggggccagcaggagatccaggaccagctgagcctgtccgaagccctgcagagagagaagatcttctttgagaaccacccatatttcagggatctgctggaggaaggaaaggccacggttccctgcctggcagaaaaacttaccagcgagctcatcacacatatctgtaaatctctgcccctgttagaaaatcaaatcaaggagactcaccagagaataacagaggagctacaaaagtatggtgtcgacataccggaagacgaaaatgaaaaaatgttcttcctgatagataaaattaatgcctttaatcaggacatcactgctctcatgcaaggagaggaaactgtaggggaggaagacattcggctgtttaccagactccgacacgagttccacaaatggagtacaataattgaaaacaattttcaagaaggccataaaattttgagtagaaaaatccagaaatttgaaaatcagtatcgtggtagagagctgccaggctttgtgaattacaggacatttgagacaatcgtgaaacagcaaatcaaggcactggaagagccggctgtggatatgctacacaccgtgacggatatggtccggcttgctttcacagatgtttcgataaaaaattttgaagagttttttaacctccacagaaccgccaagtccaaaattgaagacattagagcagaacaagagagagaaggtgagaagctgatccgcctccacttccagatggaacagattgtctactgccaggaccaggtatacaggggtgcattgcagaaggtcagagagaaggagctggaagaagaaaagaagaagaaatcctgggattttggggctttccaatccagctcggcaacagactcttccatggaggagatctttcagcacctgatggcctatcaccaggaggccagcaagcgcatctccagccacatccctttgatcatccagttcttcatgctccagacgtacggccagcagcttcagaaggccatgctgcagctcctgcaggacaaggacacctacagctggctcctgaaggagcggagcgacaccagcgacaagcggaagttcctgaaggagcggcttgcacggctgacgcaggctcggcgccggcttgcccagttccccggttaa
Sequence Length
1989
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
55,661 Da
NCBI Official Full Name
Homo sapiens myxovirus (influenza virus) resistance 1, interferon-inducible protein p78 (mouse), mRNA
NCBI Official Synonym Full Names
MX dynamin like GTPase 1
NCBI Official Symbol
MX1
NCBI Official Synonym Symbols
MX; MxA; IFI78; IFI-78K
NCBI Protein Information
interferon-induced GTP-binding protein Mx1
UniProt Protein Name
Interferon-induced GTP-binding protein Mx1
UniProt Gene Name
MX1
UniProt Synonym Gene Names
IFI-78K
UniProt Entry Name
MX1_HUMAN

NCBI Description

This gene encodes a guanosine triphosphate (GTP)-metabolizing protein that participates in the cellular antiviral response. The encoded protein is induced by type I and type II interferons and antagonizes the replication process of several different RNA and DNA viruses. There is a related gene located adjacent to this gene on chromosome 21, and there are multiple pseudogenes located in a cluster on chromosome 4. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Sep 2013]

Uniprot Description

MX1: Dynamin-like GTPase acting as a cell-autonomous host restriction factor against many viral pathogens. Shows activity against influenza viruses, rhabdovirus VSV, bunyavirus LACV, Thogoto virus, measles virus, Hantaan virus, Coxsackie virus CVB, Rift Valley fever virus RVFV, hepatitis B virus HBV, and Crimean- Congo hemorrhagic fever virus CCHFV. Belongs to the dynamin family. 2 isoforms of the human protein are produced by alternative splicing.

Protein type: Apoptosis; Hydrolase

Chromosomal Location of Human Ortholog: 21q22.3

Cellular Component: cytoplasm; cytosol; nuclear membrane; perinuclear region of cytoplasm

Molecular Function: protein binding

Biological Process: apoptosis; defense response; innate immune response; negative regulation of viral genome replication; response to virus; signal transduction

Research Articles on MX1

Similar Products

Product Notes

The MX1 mx1 (Catalog #AAA1272049) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggttgttt ccgaagtgga catcgcaaaa gctgatccag ctgctgcatc ccaccctcta ttactgaatg gagatgctac tgtggcccag aaaaatccag gctcggtggc tgagaacaac ctgtgcagcc agtatgagga gaaggtgcgc ccctgcatcg acctcattga ctccctgcgg gctctaggtg tggagcagga cctggccctg ccagccatcg ccgtcatcgg ggaccagagc tcgggcaaga gctccgtgtt ggaggcactg tcaggagttg cccttcccag aggcagcggg atcgtgacca gatgcccgct ggtgctgaaa ctgaagaaac ttgtgaacga agataagtgg agaggcaagg tcagttacca ggactacgag attgagattt cggatgcttc agaggtagaa aaggaaatta ataaagccca gaatgccatc gccggggaag gaatgggaat cagtcatgag ctaatcaccc tggagatcag ctcccgagat gtcccggatc tgactctaat agaccttcct ggcataacca gagtggctgt gggcaatcag cctgctgaca ttgggtataa gatcaagaca ctcatcaaga agtacatcca gaggcaggag acaatcagcc tggtggtggt ccccagtaat gtggacattg ccaccacaga ggctctcagc atggcccagg aggtggaccc cgagggagac aggaccatcg gaatcttgac gaagcctgat ctggtggaca aaggaactga agacaaggtt gtggacgtgg tgcggaacct cgtgttccac ctgaagaagg gttacatgat tgtcaagtgc cggggccagc aggagatcca ggaccagctg agcctgtccg aagccctgca gagagagaag atcttctttg agaaccaccc atatttcagg gatctgctgg aggaaggaaa ggccacggtt ccctgcctgg cagaaaaact taccagcgag ctcatcacac atatctgtaa atctctgccc ctgttagaaa atcaaatcaa ggagactcac cagagaataa cagaggagct acaaaagtat ggtgtcgaca taccggaaga cgaaaatgaa aaaatgttct tcctgataga taaaattaat gcctttaatc aggacatcac tgctctcatg caaggagagg aaactgtagg ggaggaagac attcggctgt ttaccagact ccgacacgag ttccacaaat ggagtacaat aattgaaaac aattttcaag aaggccataa aattttgagt agaaaaatcc agaaatttga aaatcagtat cgtggtagag agctgccagg ctttgtgaat tacaggacat ttgagacaat cgtgaaacag caaatcaagg cactggaaga gccggctgtg gatatgctac acaccgtgac ggatatggtc cggcttgctt tcacagatgt ttcgataaaa aattttgaag agttttttaa cctccacaga accgccaagt ccaaaattga agacattaga gcagaacaag agagagaagg tgagaagctg atccgcctcc acttccagat ggaacagatt gtctactgcc aggaccaggt atacaggggt gcattgcaga aggtcagaga gaaggagctg gaagaagaaa agaagaagaa atcctgggat tttggggctt tccaatccag ctcggcaaca gactcttcca tggaggagat ctttcagcac ctgatggcct atcaccagga ggccagcaag cgcatctcca gccacatccc tttgatcatc cagttcttca tgctccagac gtacggccag cagcttcaga aggccatgct gcagctcctg caggacaagg acacctacag ctggctcctg aaggagcgga gcgacaccag cgacaagcgg aagttcctga aggagcggct tgcacggctg acgcaggctc ggcgccggct tgcccagttc cccggttaa. It is sometimes possible for the material contained within the vial of "MX1, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.