Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

MUTYH cdna clone

MUTYH cDNA Clone

Gene Names
MUTYH; MYH
Synonyms
MUTYH; MUTYH cDNA Clone; MUTYH cdna clone
Ordering
For Research Use Only!
Sequence
atgacaccgctcgtctcccgcctgagtcgtctgtgggccatcatgaggaagccacgagcagccgtgggaagtggtcacaggaagcaggcagccagccaggaagggaggcagaagcatgctaagaacaacagtcaggccaagccttctgcctgtgatggcctggccaggcagccggaagaggtggtattgcaggcctctgtctcctcataccatctattcagagacgtagctgaagtcacagccttccgagggagcctgctaagctggtacgaccaagagaaacgggacctaccatggagaagacgggcagaagatgagatggacctggacaggcgggcatatgctgtgtgggtctcagaggtcatgctgcagcagacccaggttgccactgtgatcaactactataccggatggatgcagaagtggcctacactgcaggacctggccagtgcttccctggaggaggtgaatcaactctgggctggcctgggctactattctcgtggccggcggctgcaggagggagctcggaaggtggtagaggagctagggggccacatgccacgtacagcagagaccctgcagcagctcctgcctggcgtggggcgctacacagctggggccattgcctctatcgcctttggccaggcaaccggtgtggtggatggcaacgtagcacgggtgctgtgccgtgtccgagccattggtgctgatcccagcagcacccttgtttcccagcagctctggggtctagcccagcagctggtggacccagcccggccaggagatttcaaccaagcagccatggagctaggggccacagtgtgtaccccacagcgcccactgtgcagccagtgccctgtggagagcctgtgccgggcacgccagagagtggagcaggaacagctcttagcctcagggagcctgtcgggcagtcctgacgtggaggagtgtgctcccaacactggacagtgccacctgtgcctgcctccctcggagccctgggaccagaccctgggagtggtcaacttccccagaaaggccagccgcaagccccccagggaggagagctctgccacctgtgttctggaacagcctggggcccttggggcccaaattctgctggtgcagaggcccaactcaggtctgctggcaggactgtgggagttcccgtccgtgacctgggagccctcagagcagcttcagcgcaaggccctgctgcaggaactacagcgttgggctgggcccctcccagccacgcacctccggcaccttggggaggttgtccacaccttctctcacatcaagctgacatatcaagtatatgggctggccttggaagggcagaccccagtgaccaccgtaccaccaggtgctcgctggctgacgcaggaggaatttcacaccgcagctgtttccaccgccatgaaaaaggttttccgtgtgtatcagggccaacagccagggacctgtatgggttccaaaaggtcccaggtgtcctctccgtgcagtcggaaaaagccccgcatgggccagcaagtcctggataatttctttcggtctcacatctccactgatgcacacagcctcaacagtgcagcccagtga
Sequence Length
1608
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
57,446 Da
NCBI Official Full Name
Homo sapiens mutY homolog (E. coli), mRNA
NCBI Official Synonym Full Names
mutY DNA glycosylase
NCBI Official Symbol
MUTYH
NCBI Official Synonym Symbols
MYH
NCBI Protein Information
adenine DNA glycosylase
UniProt Protein Name
Adenine DNA glycosylase
UniProt Gene Name
MUTYH
UniProt Synonym Gene Names
MYH; hMYH
UniProt Entry Name
MUTYH_HUMAN

NCBI Description

This gene encodes a DNA glycosylase involved in oxidative DNA damage repair. The enzyme excises adenine bases from the DNA backbone at sites where adenine is inappropriately paired with guanine, cytosine, or 8-oxo-7,8-dihydroguanine, a major oxidatively damaged DNA lesion. The protein is localized to the nucleus and mitochondria. Mutations in this gene result in heritable predisposition to colon and stomach cancer. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]

Uniprot Description

MUTYH: Involved in oxidative DNA damage repair. Initiates repair of A*oxoG to C*G by removing the inappropriately paired adenine base from the DNA backbone. Possesses both adenine and 2- OH-A DNA glycosylase activities. Belongs to the Nth/MutY family. 6 isoforms of the human protein are produced by alternative splicing.

Protein type: Mitochondrial; Hydrolase; DNA repair, damage; Tumor suppressor; EC 3.2.2.-

Chromosomal Location of Human Ortholog: 1p34.1

Cellular Component: nucleoplasm; nucleus

Molecular Function: DNA N-glycosylase activity; MutLalpha complex binding; MutLbeta complex binding; MutSalpha complex binding; MutSbeta complex binding; protein binding

Biological Process: depurination; DNA repair; mismatch repair

Disease: Familial Adenomatous Polyposis, 2; Gastric Cancer; Pilomatrixoma

Research Articles on MUTYH

Similar Products

Product Notes

The MUTYH mutyh (Catalog #AAA1268739) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgacaccgc tcgtctcccg cctgagtcgt ctgtgggcca tcatgaggaa gccacgagca gccgtgggaa gtggtcacag gaagcaggca gccagccagg aagggaggca gaagcatgct aagaacaaca gtcaggccaa gccttctgcc tgtgatggcc tggccaggca gccggaagag gtggtattgc aggcctctgt ctcctcatac catctattca gagacgtagc tgaagtcaca gccttccgag ggagcctgct aagctggtac gaccaagaga aacgggacct accatggaga agacgggcag aagatgagat ggacctggac aggcgggcat atgctgtgtg ggtctcagag gtcatgctgc agcagaccca ggttgccact gtgatcaact actataccgg atggatgcag aagtggccta cactgcagga cctggccagt gcttccctgg aggaggtgaa tcaactctgg gctggcctgg gctactattc tcgtggccgg cggctgcagg agggagctcg gaaggtggta gaggagctag ggggccacat gccacgtaca gcagagaccc tgcagcagct cctgcctggc gtggggcgct acacagctgg ggccattgcc tctatcgcct ttggccaggc aaccggtgtg gtggatggca acgtagcacg ggtgctgtgc cgtgtccgag ccattggtgc tgatcccagc agcacccttg tttcccagca gctctggggt ctagcccagc agctggtgga cccagcccgg ccaggagatt tcaaccaagc agccatggag ctaggggcca cagtgtgtac cccacagcgc ccactgtgca gccagtgccc tgtggagagc ctgtgccggg cacgccagag agtggagcag gaacagctct tagcctcagg gagcctgtcg ggcagtcctg acgtggagga gtgtgctccc aacactggac agtgccacct gtgcctgcct ccctcggagc cctgggacca gaccctggga gtggtcaact tccccagaaa ggccagccgc aagcccccca gggaggagag ctctgccacc tgtgttctgg aacagcctgg ggcccttggg gcccaaattc tgctggtgca gaggcccaac tcaggtctgc tggcaggact gtgggagttc ccgtccgtga cctgggagcc ctcagagcag cttcagcgca aggccctgct gcaggaacta cagcgttggg ctgggcccct cccagccacg cacctccggc accttgggga ggttgtccac accttctctc acatcaagct gacatatcaa gtatatgggc tggccttgga agggcagacc ccagtgacca ccgtaccacc aggtgctcgc tggctgacgc aggaggaatt tcacaccgca gctgtttcca ccgccatgaa aaaggttttc cgtgtgtatc agggccaaca gccagggacc tgtatgggtt ccaaaaggtc ccaggtgtcc tctccgtgca gtcggaaaaa gccccgcatg ggccagcaag tcctggataa tttctttcgg tctcacatct ccactgatgc acacagcctc aacagtgcag cccagtga. It is sometimes possible for the material contained within the vial of "MUTYH, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.