Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

MTMR14 cdna clone

MTMR14 cDNA Clone

Gene Names
MTMR14; C3orf29
Synonyms
MTMR14; MTMR14 cDNA Clone; MTMR14 cdna clone
Ordering
For Research Use Only!
Sequence
atggcccggtgcagaggacggtttgtctgcccagtaatcctgttcaagggcaagcacatttgcaggtcggccacactggctggatggggagagctgtatggacgctcaggctacaactattttttctcagggggtgcagatgatgcctgggcagatgtggaggacgtcacggaggaggactgtgctcttcgaagtggtgacacgcatctttttgataaggtcagaggctatgacatcaagctgcttcgatacctgtcagtcaaatacatctgtgacctgatggtggagaacaagaaggtgaagtttggcatgaatgtaacctcctctgagaaggtggacaaagcccagcgctatgccgacttcactctcctctccatcccgtatccaggctgtgaatttttcaaggaatataaagatcgggattacatggcagaagggctcatatttaactggaagcaggactacgttgatgccccattgagcatccccgacttcctgactcactctctgaacattgactggagccagtatcagtgttgggatctggtgcaacaaacacaaaactacctgaagctgctgctttccttagttaacagtgatgatgacagcgggctgctggtacactgtatctcaggctgggatcggacccccctcttcatctccctcctgcgcctttccttgtgggctgatgggctcatccacacgtccctgaagcccactgagatcctctacctcactgtggcctatgactggttcctcttcgggcacatgttggtagatcggctcagcaaaggggaggagattttcttcttctgcttcaattttttgaagcatattacctccgaggagttctctgctctgaagacccagaggaggaagagtttgccagcccgggatggaggcttcaccctggaagacatctgcatgctgagacgaaaggaccgtggcagcaccaccagccttggcagcgacttctccctggtcatggagagttccccaggagccactgggagcttcacctatgaggccgtggagctggtcccagcaggagcgccaactcaggcagcttggcttgcagccctgagtgatcgagagactcggctgcaggaggtgcgctcagccttcttggctgcgtacagcagcacagtggggcttcgggcagtagcccccagtccttccggtgccatcgggggcctgctggagcaatttgcccgtggtgttggactccggagcatcagcagcaatgccttgtga
Sequence Length
1254
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
60,035 Da
NCBI Official Full Name
Homo sapiens myotubularin related protein 14, mRNA
NCBI Official Synonym Full Names
myotubularin related protein 14
NCBI Official Symbol
MTMR14
NCBI Official Synonym Symbols
C3orf29
NCBI Protein Information
myotubularin-related protein 14
UniProt Protein Name
Myotubularin-related protein 14
UniProt Gene Name
MTMR14
UniProt Synonym Gene Names
C3orf29; NS5ATP4ABP1
UniProt Entry Name
MTMRE_HUMAN

NCBI Description

This gene encodes a myotubularin-related protein. The encoded protein is a phosphoinositide phosphatase that specifically dephosphorylates phosphatidylinositol 3,5-biphosphate and phosphatidylinositol 3-phosphate. Mutations in this gene are correlated with autosomal dominant centronuclear myopathy. Alternate splicing results in multiple transcript variants. A pseudogene of this gene is found on chromosome 18.[provided by RefSeq, Apr 2010]

Uniprot Description

MTMR14: Lipid phosphatase which efficiently dephosphorylates phosphatidylinositol 3-phosphate (PtdIns3P) and PtdIns(3,5)P2; inactive toward PtdIns4P, PtdIns(3,4)P2, PtdIns(4,5)P2 and PtdIns(3,4,5)P3. Expressed in various tissues, including heart, skeletal muscle, placenta, liver, lung, kidney and pancreas. Belongs to the protein-tyrosine phosphatase family. Non-receptor class myotubularin subfamily. 3 isoforms of the human protein are produced by alternative splicing.

Protein type: EC 3.1.3.-; Phosphatase, lipid; Protein phosphatase, tyrosine (non-receptor)

Chromosomal Location of Human Ortholog: 3p26

Cellular Component: cytosol; perinuclear region of cytoplasm; ruffle

Molecular Function: phosphatidylinositol-3-phosphatase activity; protein binding; protein serine/threonine phosphatase activity

Biological Process: macroautophagy; phosphatidylinositol biosynthetic process

Disease: Myopathy, Centronuclear, 1

Research Articles on MTMR14

Similar Products

Product Notes

The MTMR14 mtmr14 (Catalog #AAA1271443) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggcccggt gcagaggacg gtttgtctgc ccagtaatcc tgttcaaggg caagcacatt tgcaggtcgg ccacactggc tggatgggga gagctgtatg gacgctcagg ctacaactat tttttctcag ggggtgcaga tgatgcctgg gcagatgtgg aggacgtcac ggaggaggac tgtgctcttc gaagtggtga cacgcatctt tttgataagg tcagaggcta tgacatcaag ctgcttcgat acctgtcagt caaatacatc tgtgacctga tggtggagaa caagaaggtg aagtttggca tgaatgtaac ctcctctgag aaggtggaca aagcccagcg ctatgccgac ttcactctcc tctccatccc gtatccaggc tgtgaatttt tcaaggaata taaagatcgg gattacatgg cagaagggct catatttaac tggaagcagg actacgttga tgccccattg agcatccccg acttcctgac tcactctctg aacattgact ggagccagta tcagtgttgg gatctggtgc aacaaacaca aaactacctg aagctgctgc tttccttagt taacagtgat gatgacagcg ggctgctggt acactgtatc tcaggctggg atcggacccc cctcttcatc tccctcctgc gcctttcctt gtgggctgat gggctcatcc acacgtccct gaagcccact gagatcctct acctcactgt ggcctatgac tggttcctct tcgggcacat gttggtagat cggctcagca aaggggagga gattttcttc ttctgcttca attttttgaa gcatattacc tccgaggagt tctctgctct gaagacccag aggaggaaga gtttgccagc ccgggatgga ggcttcaccc tggaagacat ctgcatgctg agacgaaagg accgtggcag caccaccagc cttggcagcg acttctccct ggtcatggag agttccccag gagccactgg gagcttcacc tatgaggccg tggagctggt cccagcagga gcgccaactc aggcagcttg gcttgcagcc ctgagtgatc gagagactcg gctgcaggag gtgcgctcag ccttcttggc tgcgtacagc agcacagtgg ggcttcgggc agtagccccc agtccttccg gtgccatcgg gggcctgctg gagcaatttg cccgtggtgt tggactccgg agcatcagca gcaatgcctt gtga. It is sometimes possible for the material contained within the vial of "MTMR14, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.