Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

MTM1 cdna clone

MTM1 cDNA Clone

Gene Names
MTM1; CNM; MTMX; XLMTM
Synonyms
MTM1; MTM1 cDNA Clone; MTM1 cdna clone
Ordering
For Research Use Only!
Sequence
atggcttctgcatcaacttctaaatataattcacactccttggagaatgagtctattaagaggacgtctcgagatggagtcaatcgagatctcactgaggctgttcctcgacttccaggagaaacactaatcactgacaaagaagttatttacatatgtcctttcaatggccccattaagggaagagtttacatcacaaattatcgtctttatttaagaagtttggaaacggattcttctctaatacttgatgttcctctgggtgtgatctcgagaattgaaaaaatgggaggcgcgacaagtagaggagaaaattcctatggtctagatattacttgtaaagacatgagaaacctgaggttcgctttgaaacaggaaggccacagcagaagagatatgtttgagatcctcacgagatacgcgtttcccctggctcacagtctgccattatttgcatttttaaatgaagaaaagtttaacgtggatggatggacagtttacaatccagtggaagaatacaggaggcagggcttgcccaatcaccattggagaataacttttattaataagtgctatgagctctgtgacacttaccctgctcttttggtggttccgtatcgtgcctcagatgatgacctccggagagttgcaacttttaggtcccgaaatcgaattccagtgctgtcatggattcatccagaaaataagacggtcattgtgcgttgcagtcagcctcttgtcggtatgagtgggaaacgaaataaagatgatgagaaatatctcgatgttatcagggagactaataaacaaatttctaaactcaccatttatgatgcaagacccagcgtaaatgcagtggccaacaaggcaacaggaggaggatatgaaagtgatgatgcatatcataacgccgaacttttcttcttagacattcataatattcatgttatgcgggaatctttaaaaaaagtgaaggacattgtttatcctaatgtagaagaatctcattggttgtccagtttggagtctactcattggttagaacatatcaagctcgttttgacaggagccattcaagtagcagacaaagtttcttcagggaagagttcagtgcttgtgcattgcagtgacggatgggacaggactgctcagctgacatccttggccatgctgatgttggatagcttctataggagcattgaagggttcgaaatactggtacaaaaaaaatggataagttttggacataaatttgcatctcgaataggtcatggtgataaaaaccacaccgatgctgaccgttctcctatttttctccagtttattgattgtgtgtggcaaatgtcaaaacagttccctacagcttttgaattcaatgaacaatttttgattataattttggatcatctgtatagttgccgatttggtactttcttattcaactgtgaatctgctcgagaaagacagaaggttacagaaaggactgtttctttatggtcactgataaacagtaataaagaaaaattcaaaaaccccttctatactaaagaaatcaatcgagttttatatccagttgccagtatgcgtcacttggaactctgggtgaattactacattagatggaaccccaggatcaagcaacaacagccgaatccagtggagcagcgttacatggagctcttagccttacgcgacgaatacataaagcggcttgaggaactgcagctcgccaactctgccaagctttctgatcccccaacttcaccttccagtccttcgcaaatgatgccccatgtgcaaactcacttctga
Sequence Length
1812
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
66,053 Da
NCBI Official Full Name
Homo sapiens myotubularin 1, mRNA
NCBI Official Synonym Full Names
myotubularin 1
NCBI Official Symbol
MTM1
NCBI Official Synonym Symbols
CNM; MTMX; XLMTM
NCBI Protein Information
myotubularin
UniProt Protein Name
Myotubularin
Protein Family
UniProt Gene Name
MTM1
UniProt Synonym Gene Names
CG2
UniProt Entry Name
MTM1_HUMAN

NCBI Description

This gene encodes a dual-specificity phosphatase that acts on both phosphotyrosine and phosphoserine. It is required for muscle cell differentiation and mutations in this gene have been identified as being responsible for X-linked myotubular myopathy. [provided by RefSeq, Jul 2008]

Uniprot Description

MTM1: Lipid phosphatase which dephosphorylates phosphatidylinositol 3-monophosphate (PI3P) and phosphatidylinositol 3,5-bisphosphate (PI(3,5)P2). Has also been shown to dephosphorylate phosphotyrosine- and phosphoserine- containing peptides. Negatively regulates EGFR degradation through regulation of EGFR trafficking from the late endosome to the lysosome. Plays a role in vacuolar formation and morphology. Regulates desmin intermediate filament assembly and architecture. Plays a role in mitochondrial morphology and positioning. Required for skeletal muscle maintenance but not for myogenesis. Defects in MTM1 are the cause of centronuclear myopathy X-linked (CNMX). A congenital muscle disorder characterized by progressive muscular. weakness and wasting involving mainly limb girdle, trunk, and neck muscles. It may also affect distal muscles. Weakness may be present during childhood or adolescence or may not become evident until the third decade of life. Ptosis is a frequent clinical feature. The most prominent histopathologic features include high frequency of centrally located nuclei in muscle fibers not secondary to regeneration, radial arrangement of sarcoplasmic strands around the central nuclei, and predominance and hypotrophy of type 1 fibers. Belongs to the protein-tyrosine phosphatase family. Non-receptor class myotubularin subfamily.

Protein type: Protein phosphatase, dual-specificity; EC 3.1.3.95; Motility/polarity/chemotaxis; EC 3.1.3.64

Chromosomal Location of Human Ortholog: Xq28

Cellular Component: cytoplasm; cytosol; filopodium; late endosome; plasma membrane; ruffle

Molecular Function: intermediate filament binding; phosphatidylinositol-3-phosphatase activity; phosphoinositide binding; phosphoprotein phosphatase activity; protein binding

Biological Process: endosome to lysosome transport; intermediate filament organization; mitochondrion distribution; phosphatidylinositol biosynthetic process; phosphoinositide dephosphorylation; protein amino acid dephosphorylation

Disease: Myopathy, Centronuclear, X-linked

Research Articles on MTM1

Similar Products

Product Notes

The MTM1 mtm1 (Catalog #AAA1265946) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggcttctg catcaacttc taaatataat tcacactcct tggagaatga gtctattaag aggacgtctc gagatggagt caatcgagat ctcactgagg ctgttcctcg acttccagga gaaacactaa tcactgacaa agaagttatt tacatatgtc ctttcaatgg ccccattaag ggaagagttt acatcacaaa ttatcgtctt tatttaagaa gtttggaaac ggattcttct ctaatacttg atgttcctct gggtgtgatc tcgagaattg aaaaaatggg aggcgcgaca agtagaggag aaaattccta tggtctagat attacttgta aagacatgag aaacctgagg ttcgctttga aacaggaagg ccacagcaga agagatatgt ttgagatcct cacgagatac gcgtttcccc tggctcacag tctgccatta tttgcatttt taaatgaaga aaagtttaac gtggatggat ggacagttta caatccagtg gaagaataca ggaggcaggg cttgcccaat caccattgga gaataacttt tattaataag tgctatgagc tctgtgacac ttaccctgct cttttggtgg ttccgtatcg tgcctcagat gatgacctcc ggagagttgc aacttttagg tcccgaaatc gaattccagt gctgtcatgg attcatccag aaaataagac ggtcattgtg cgttgcagtc agcctcttgt cggtatgagt gggaaacgaa ataaagatga tgagaaatat ctcgatgtta tcagggagac taataaacaa atttctaaac tcaccattta tgatgcaaga cccagcgtaa atgcagtggc caacaaggca acaggaggag gatatgaaag tgatgatgca tatcataacg ccgaactttt cttcttagac attcataata ttcatgttat gcgggaatct ttaaaaaaag tgaaggacat tgtttatcct aatgtagaag aatctcattg gttgtccagt ttggagtcta ctcattggtt agaacatatc aagctcgttt tgacaggagc cattcaagta gcagacaaag tttcttcagg gaagagttca gtgcttgtgc attgcagtga cggatgggac aggactgctc agctgacatc cttggccatg ctgatgttgg atagcttcta taggagcatt gaagggttcg aaatactggt acaaaaaaaa tggataagtt ttggacataa atttgcatct cgaataggtc atggtgataa aaaccacacc gatgctgacc gttctcctat ttttctccag tttattgatt gtgtgtggca aatgtcaaaa cagttcccta cagcttttga attcaatgaa caatttttga ttataatttt ggatcatctg tatagttgcc gatttggtac tttcttattc aactgtgaat ctgctcgaga aagacagaag gttacagaaa ggactgtttc tttatggtca ctgataaaca gtaataaaga aaaattcaaa aaccccttct atactaaaga aatcaatcga gttttatatc cagttgccag tatgcgtcac ttggaactct gggtgaatta ctacattaga tggaacccca ggatcaagca acaacagccg aatccagtgg agcagcgtta catggagctc ttagccttac gcgacgaata cataaagcgg cttgaggaac tgcagctcgc caactctgcc aagctttctg atcccccaac ttcaccttcc agtccttcgc aaatgatgcc ccatgtgcaa actcacttct ga. It is sometimes possible for the material contained within the vial of "MTM1, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.