MTERFD3 cdna clone

MTERFD3 cDNA Clone

Gene Names

MTERF2; mTERFL; MTERFD3

Synonyms

MTERFD3; MTERFD3 cDNA Clone; MTERFD3 cdna clone

Ordering
Cat. Num. AAA1266342 For Research Use Only!

Sequence

atgttgtggaagctgctgctgagatcccagtcctgcaggctgtgttctttcagaaagatgcgatcacctccaaaatacagacctttcttagcatgcttcacctatacaactgataaacagtcgagcaaagaaaatacaagaacagtggaaaagctctataaatgttcagttgacattaggaaaattcgtagattaaaaggatgggtacttttagaggatgaaacctatgttgaagaaattgcgaatattttacaagaactaggtgccgatgagactgctgtagccagtattttggaacgctgcccggaagcaattgtctgtagtccaaccgctgttaacacccagagaaaactctggcagttggtctgcaaaaatgaggaagagttaatcaagttaatagagcagtttccagaatctttctttactattaaagaccaagagaaccagaagctgaatgttcagttctttcaagagttgggactaaaaaatgtggtcattagcagacttttgacagctgcacctaatgtttttcataatcctgttgagaagaataagcaaatggtaagaattctccaagagagttatctagatgtaggtggctctgaggccaacatgaaagtttggctactaaaattgttaagccaaaacccatttattttgttaaattctcccacagctataaaggaaacactagaatttctccaggagcaaggtttcaccagctttgaaattctccagcttctatccaaactcaaaggatttctttttcaactttgcccaagaagtatacagaatagtatttccttctctaaaaatgcttttaaatgcacagatcatgacctgaagcaattagttttgaaatgtcctgcccttttatattattctgttccagttttagaagagagaatgcaaggattattgagagaaggaatttccatagctcagataagagagacgccaatggttcttgaattaacaccacagatagtacagtacaggataaggaaactgaattcctcaggctacagaataaaggatggacatctagcaaatctaaatggatcaaaaaaagagtttgaagctaattttggcaaaattcaggccaaaaaagtaaggccattatttaaccctgtggcaccattaaatgttgaagaatga

Sequence Length

1158

Vector

Please Inquire

NCBI and Uniprot Product Information

NCBI GI #

19683944

NCBI GeneID

80298

Molecular Weight

44,414 Da

NCBI Official Full Name

Homo sapiens MTERF domain containing 3, mRNA

NCBI Official Synonym Full Names

mitochondrial transcription termination factor 2

NCBI Official Symbol

MTERF2

NCBI Official Synonym Symbols

mTERFL; MTERFD3

NCBI Protein Information

transcription termination factor 2, mitochondrial

UniProt Protein Name

Transcription termination factor 2, mitochondrial

UniProt Gene Name

MTERF2

UniProt Synonym Gene Names

MTERFD3; mTERF2; mTERF-like; mTERFL

UniProt Entry Name

MTEF2_HUMAN

Uniprot Description

MTERFD3: Binds promoter DNA and regulates mitochondrial transcription. Required for normal levels of transcription, both for mRNA and tRNA. Required for normal mitochondrial protein synthesis, assembly of respiratory complexes and normal mitochondrial function. Belongs to the mTERF family.

Chromosomal Location of Human Ortholog: 12q24.1

Cellular Component: mitochondrial matrix

Molecular Function: nucleic acid binding

Biological Process: regulation of transcription, DNA-dependent; termination of mitochondrial transcription; transcription, DNA-dependent

Research Articles on MTERFD3

1. These findings demonstrate that MTERF2 contributes to MPP(+)-induced mitochondrial disruption and cell damage.

Similar Products

Product Notes

The MTERFD3 mterf2 (Catalog #AAA1266342) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgttgtgga agctgctgct gagatcccag tcctgcaggc tgtgttcttt cagaaagatg cgatcacctc caaaatacag acctttctta gcatgcttca cctatacaac tgataaacag tcgagcaaag aaaatacaag aacagtggaa aagctctata aatgttcagt tgacattagg aaaattcgta gattaaaagg atgggtactt ttagaggatg aaacctatgt tgaagaaatt gcgaatattt tacaagaact aggtgccgat gagactgctg tagccagtat tttggaacgc tgcccggaag caattgtctg tagtccaacc gctgttaaca cccagagaaa actctggcag ttggtctgca aaaatgagga agagttaatc aagttaatag agcagtttcc agaatctttc tttactatta aagaccaaga gaaccagaag ctgaatgttc agttctttca agagttggga ctaaaaaatg tggtcattag cagacttttg acagctgcac ctaatgtttt tcataatcct gttgagaaga ataagcaaat ggtaagaatt ctccaagaga gttatctaga tgtaggtggc tctgaggcca acatgaaagt ttggctacta aaattgttaa gccaaaaccc atttattttg ttaaattctc ccacagctat aaaggaaaca ctagaatttc tccaggagca aggtttcacc agctttgaaa ttctccagct tctatccaaa ctcaaaggat ttctttttca actttgccca agaagtatac agaatagtat ttccttctct aaaaatgctt ttaaatgcac agatcatgac ctgaagcaat tagttttgaa atgtcctgcc cttttatatt attctgttcc agttttagaa gagagaatgc aaggattatt gagagaagga atttccatag ctcagataag agagacgcca atggttcttg aattaacacc acagatagta cagtacagga taaggaaact gaattcctca ggctacagaa taaaggatgg acatctagca aatctaaatg gatcaaaaaa agagtttgaa gctaattttg gcaaaattca ggccaaaaaa gtaaggccat tatttaaccc tgtggcacca ttaaatgttg aagaatga. It is sometimes possible for the material contained within the vial of "MTERFD3, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Loading...

MTERFD3 cdna clone