Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

MTAP cdna clone

MTAP cDNA Clone

Gene Names
MTAP; BDMF; MSAP; DMSFH; LGMBF; DMSMFH; c86fus; HEL-249
Synonyms
MTAP; MTAP cDNA Clone; MTAP cdna clone
Ordering
For Research Use Only!
Sequence
atggcctctggcaccaccaccaccgccgtgaagattggaataattggtggaacaggcctggatgatccagaaattttagaaggaagaactgaaaaatatgtggatactccatttggcaagccatctgatgccttaattttggggaagataaaaaatgttgattgcatcctccttgcaaggcatggaaggcagcacaccatcatgccttcaaaggtcaactaccaggcgaacatctgggctttgaaggaagagggctgtacacatgtcatagtgaccacagcttgtggctccttgagggaggagattcagcccggcgatattgtcattattgatcagttcattgacagccatgtaagacgtgcctgcttccccttcaccttccatcatgattgtttccagagacctccccagaagccaagcagaagccactgtgtttcctgtgcaacctgcagaaccatgagctaa
Sequence Length
465
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
26,278 Da
NCBI Official Full Name
Homo sapiens methylthioadenosine phosphorylase, mRNA
NCBI Official Synonym Full Names
methylthioadenosine phosphorylase
NCBI Official Symbol
MTAP
NCBI Official Synonym Symbols
BDMF; MSAP; DMSFH; LGMBF; DMSMFH; c86fus; HEL-249
NCBI Protein Information
S-methyl-5'-thioadenosine phosphorylase
UniProt Protein Name
S-methyl-5'-thioadenosine phosphorylase
UniProt Gene Name
MTAP
UniProt Synonym Gene Names
MTA phosphorylase; MTAP; MTAPase
UniProt Entry Name
MTAP_HUMAN

NCBI Description

This gene encodes an enzyme that plays a major role in polyamine metabolism and is important for the salvage of both adenine and methionine. The encoded enzyme is deficient in many cancers because this gene and the tumor suppressor p16 gene are co-deleted. Multiple alternatively spliced transcript variants have been described for this gene, but their full-length natures remain unknown. [provided by RefSeq, Jul 2008]

Uniprot Description

MTAP: Catalyzes the reversible phosphorylation of S-methyl-5'- thioadenosine (MTA) to adenine and 5-methylthioribose-1-phosphate. Involved in the breakdown of MTA, a major by-product of polyamine biosynthesis. Responsible for the first step in the methionine salvage pathway after MTA has been generated from S- adenosylmethionine. Has broad substrate specificity with 6- aminopurine nucleosides as preferred substrates. Homotrimer. Ubiquitously expressed. Inhibited by 5'-methylthiotubercin and 5'- chloroformycin. Belongs to the PNP/MTAP phosphorylase family. MTAP subfamily.

Protein type: EC 2.4.2.28; Amino Acid Metabolism - cysteine and methionine; Phosphorylase; Transferase

Chromosomal Location of Human Ortholog: 9p21

Cellular Component: cytoplasm; cytosol

Molecular Function: phosphorylase activity; protein binding; S-methyl-5-thioadenosine phosphorylase activity

Biological Process: methionine salvage; nicotinamide riboside catabolic process; nucleobase, nucleoside, nucleotide and nucleic acid metabolic process; purine salvage

Research Articles on MTAP

Similar Products

Product Notes

The MTAP mtap (Catalog #AAA1275903) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggcctctg gcaccaccac caccgccgtg aagattggaa taattggtgg aacaggcctg gatgatccag aaattttaga aggaagaact gaaaaatatg tggatactcc atttggcaag ccatctgatg ccttaatttt ggggaagata aaaaatgttg attgcatcct ccttgcaagg catggaaggc agcacaccat catgccttca aaggtcaact accaggcgaa catctgggct ttgaaggaag agggctgtac acatgtcata gtgaccacag cttgtggctc cttgagggag gagattcagc ccggcgatat tgtcattatt gatcagttca ttgacagcca tgtaagacgt gcctgcttcc ccttcacctt ccatcatgat tgtttccaga gacctcccca gaagccaagc agaagccact gtgtttcctg tgcaacctgc agaaccatga gctaa. It is sometimes possible for the material contained within the vial of "MTAP, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.