Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

MSI2 cdna clone

MSI2 cDNA Clone

Gene Names
MSI2; MSI2H
Synonyms
MSI2; MSI2 cDNA Clone; MSI2 cdna clone
Ordering
For Research Use Only!
Sequence
atggtcacaagaacaaagaaaatatttgtaggcgggttatctgcgaacacagtagtggaagatgtaaagcaatatttcgagcagtttggcaaggtggaagatgcaatgctgatgtttgataaaactaccaacaggcacagagggtttggctttgtcacttttgagaatgaagatgttgtggagaaagtctgtgagattcatttccatgaaatcaataataaaatggtagaatgtaagaaagctcagccgaaagaagtcatgttcccacctgggacaagaggccgggcccggggactgccttacaccatggacgcgttcatgcttggcatggggatgctgggatatcccaacttcgtggcgacctatggccgtggctaccccggatttgctccaagctatggctatcagttcccagactatttgccggtttcacaagacataatttttatcaactag
Sequence Length
456
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
17,238 Da
NCBI Official Full Name
Homo sapiens musashi homolog 2 (Drosophila), mRNA
NCBI Official Synonym Full Names
musashi RNA binding protein 2
NCBI Official Symbol
MSI2
NCBI Official Synonym Symbols
MSI2H
NCBI Protein Information
RNA-binding protein Musashi homolog 2
UniProt Protein Name
RNA-binding protein Musashi homolog 2
Protein Family
UniProt Gene Name
MSI2
UniProt Synonym Gene Names
Musashi-2
UniProt Entry Name
MSI2H_HUMAN

NCBI Description

This gene encodes an RNA-binding protein that is a member of the Musashi protein family. The encoded protein is transcriptional regulator that targets genes involved in development and cell cycle regulation. Mutations in this gene are associated with poor prognosis in certain types of cancers. This gene has also been shown to be rearranged in certain cancer cells. [provided by RefSeq, Apr 2016]

Uniprot Description

Musashi-2: RNA binding protein that regulates the expression of target mRNAs at the translation level. May play a role in the proliferation and maintenance of stem cells in the central nervous system. Chromosomal aberrations involving MSI2 may contribute to disease progression in chronic myeloid leukemia. Translocation t(7;17)(p15;q23) with HOXA9; translocation t(7;17)(q32-34;q23). Belongs to the Musashi family. 3 isoforms of the human protein are produced by alternative splicing.

Protein type: RNA-binding

Chromosomal Location of Human Ortholog: 17q22

Molecular Function: protein binding

Research Articles on MSI2

Similar Products

Product Notes

The MSI2 msi2 (Catalog #AAA1266758) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggtcacaa gaacaaagaa aatatttgta ggcgggttat ctgcgaacac agtagtggaa gatgtaaagc aatatttcga gcagtttggc aaggtggaag atgcaatgct gatgtttgat aaaactacca acaggcacag agggtttggc tttgtcactt ttgagaatga agatgttgtg gagaaagtct gtgagattca tttccatgaa atcaataata aaatggtaga atgtaagaaa gctcagccga aagaagtcat gttcccacct gggacaagag gccgggcccg gggactgcct tacaccatgg acgcgttcat gcttggcatg gggatgctgg gatatcccaa cttcgtggcg acctatggcc gtggctaccc cggatttgct ccaagctatg gctatcagtt cccagactat ttgccggttt cacaagacat aatttttatc aactag. It is sometimes possible for the material contained within the vial of "MSI2, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.