Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

MSH6 cdna clone

MSH6 cDNA Clone

Gene Names
MSH6; GTBP; HSAP; p160; GTMBP; HNPCC5
Synonyms
MSH6; MSH6 cDNA Clone; MSH6 cdna clone
Ordering
For Research Use Only!
Sequence
atgtcgcgacagagcaccctgtacagcttcttccccaagtctccggcgctgagtgatgccaacaaggcctcggccagggcctcacgcgaaggcggccgtgccgccgctgcccccggggcctctccttccccaggcggggatgcggcctggagcgaggctgggcctgggcccaggcccttggcgcgatccgcgtcaccgcccaaggcgaagaacctcaacggagggctgcggagatcggtagcgcctgctgcccccaccagttgtgacttctcaccgggagatttggtttgggccaagatggagggttacccctggtggccttgtctggtttacaaccacccctttgatggaacattcatccgcgagaaagggaaatcagtccgtgttcatgtacagttttttgatgacagcccaacaaggggctgggttagcaaaaggcttttaaagccatatacaggttcaaaatcaaaggaagcccagaagggaggtcatttttacagtgcaaagcctgaaatactgagagcaatgcaacgtgcagacgaagccttaaataaagacaagattaagaggcttgaattggcagtttgtgatgagccctcagagccagaagaggaagaagagatggaggtaggcacaacttacgtaacagataagagtgaagaagataatgaaattgagagtgaagaggaagtacagcctaagacacaaggatctaggcgaagtagccgccaaataaaaaaacgaagggtcatatcagattctgagagtgacattggtggctctgatgtggaatttaagccagacactaaggaggaaggaagcagtgatgaaataagcagtggagtgggggatagtgagagtgaaggcctgaacagccctgtcaaagttgctcgaaagcggaagagaatggtgactggaaatggctctcttaaaaggaaaagctctaggaaggaaacgccctcagccaccaaacaagcaactagcatttcatcagaaaccaagaatactttgagagctttctctgcccctcaaaattctgaatcccaagcccacgttagtggaggtggtgatgacagtagtcgccctactgtttggtatcatgaaactttagaatggcttaaggaggaaaagagaagagatgagcacaggaggaggcctgatcaccccgattttgatgcatctacactctatgtgcctgaggatttcctcaattcttgtactcctgggatgaggaagtggtggcagattaagtctcagaactttgatcttgtcatctgttacaaggtggggaaattttatgagctgtaccacatggatgctcttattggagtcagtgaactggggctggtattcatgaaaggcaactgggcccattctggctttcctgaaattgcatttggccgttattcagattccctggtgcagaagggctataaagtagcacgagtggaacagactgagactccagaaatgatggaggcacgatgtagaaagatggcacatatatccaagtatgatagagtggtgaggagggagatctgtaggatcattaccaagggtacacagacttacagtgtgctggaaggtgatccctctgagaactacagtaagtatcttcttagcctcaaagaaaaagaggaagattcttctggccatactcgtgcatatggtgtgtgctttgttgatacttcactgggaaagtttttcataggtcagttttcagatgatcgccattgttcgagatttaggactctagtggcacactatcccccagtacaagttttatttgaaaaaggaaatctctcaaaggaaactaaaacaattctaaagagttcattgtcctgttctcttcaggaaggtctgatacccggctcccagttttgggatgcatccaaaactttgagaactctccttgaggaagaatattttagggaaaagctaagtgatggcattggggtgatgttaccccaggtgcttaaaggtatgacttcagagtctgattccattgggttgacaccaggagagaaaagtgaattggccctctctgctctaggtggttgtgtcttctacctcaaaaaatgccttattgatcaggagcttttatcaatggctaattttgaagaatatattcccttggattctgacacagtcagcactacaagatctggtgctatcttcaccaaagcctatcaacgaatggtgctagatgcagtgacattaaacaacttggagatttttctgaatggaacaaatggttctactgaaggaaccctactagagagggttgatacttgccatactccttttggtaagcggctcctaaagcaatggctttgtgccccactctgtaaccattatgctattaatgatcgtctagatgccatagaagacctcatggttgtgcctgacaaaatctccgaagttgtagagcttctaaagaagcttccagatcttgagaggctactcagtaaaattcataatgttgggtctcccctgaagagtcagaaccacccagacagcagggctataatgtatgaagaaactacatacagcaagaagaagattattgattttctttctgctctggaaggattcaaagtaatgtgtaaaattatagggatcatggaagaagttgctgatggttttaagtctaaaatccttaagcaggtcatctctctgcagacaaaaaatcctgaaggtcgttttcctgatttgactgtagaattgaaccgatgggatacagcctttgaccatgaaaaggctcgaaagactggacttattactcccaaagcaggctttgactctgattatgaccaagctcttgctgacataagagaaaatgaacagagcctcctggaatacctagagaaacagcgcaacagaattggctgtaggaccatagtctattgggggattggtaggaaccgttaccagctggaaattcctgagaatttcaccactcgcaatttgccagaagaatacgagttgaaatctaccaagaagggctgtaaacgatactggaccaaaactattgaaaagaagttggctaatctcataaatgctgaagaacggagggatgtatcattgaaggactgcatgcggcgactgttctataactttgataaaaattacaaggactggcagtctgctgtagagtgtatcgcagtgttggatgttttactgtgcctggctaactatagtcgagggggtgatggtcctatgtgtcgcccagtaattctgttgccggaagataccccccccttcttagagcttaaaggatcacgccatccttgcattacgaagactttttttggagatgattttattcctaatgacattctaataggctgtgaggaagaggagcaggaaaatggcaaagcctattgtgtgcttgttactggaccaaatatggggggcaagtctacgcttatgagacaggctggcttattagctgtaatggcccagatgggttgttacgtccctgctgaagtgtgcaggctcacaccaattgatagagtgtttactagacttggtgcctcagacagaataatgtcaggtgaaagtacattttttgttgaattaagtgaaactgccagcatactcatgcatgcaacagcacattctctggtgcttgtggatgaattaggaagaggtactgcaacatttgatgggacggcaatagcaaatgcagttgttaaagaacttgctgagactataaaatgtcgtacattattttcaactcactaccattcattagtagaagattattctcaaaatgttgctgtgcgcctaggacatatggcatgcatggtagaaaatgaatgtgaagaccccagccaggagactattacgttcctctataaattcattaagggagcttgtcctaaaagctatggctttaatgcagcaaggcttgctaatctcccagaggaagttattcaaaagggacatagaaaagcaagagaatttgagaagatgaatcagtcactacgattatttcgggaagtttgcctggctagtgaaaggtcaactgtagatgctgaagctgtccataaattgctgactttgattaaggaattatag
Sequence Length
4083
Vector
Please Inquire

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
119,796 Da
NCBI Official Full Name
Homo sapiens mutS homolog 6 (E. coli), mRNA
NCBI Official Synonym Full Names
mutS homolog 6
NCBI Official Symbol
MSH6
NCBI Official Synonym Symbols
GTBP; HSAP; p160; GTMBP; HNPCC5
NCBI Protein Information
DNA mismatch repair protein Msh6
UniProt Protein Name
DNA mismatch repair protein Msh6
UniProt Gene Name
MSH6
UniProt Synonym Gene Names
GTBP; hMSH6; GTBP; GTMBP; p160
UniProt Entry Name
MSH6_HUMAN

NCBI Description

This gene encodes a member of the DNA mismatch repair MutS family. In E. coli, the MutS protein helps in the recognition of mismatched nucleotides prior to their repair. A highly conserved region of approximately 150 aa, called the Walker-A adenine nucleotide binding motif, exists in MutS homologs. The encoded protein heterodimerizes with MSH2 to form a mismatch recognition complex that functions as a bidirectional molecular switch that exchanges ADP and ATP as DNA mismatches are bound and dissociated. Mutations in this gene may be associated with hereditary nonpolyposis colon cancer, colorectal cancer, and endometrial cancer. Transcripts variants encoding different isoforms have been described. [provided by RefSeq, Jul 2013]

Uniprot Description

MSH6: Component of the post-replicative DNA mismatch repair system (MMR). Heterodimerizes with MSH2 to form MutS alpha, which binds to DNA mismatches thereby initiating DNA repair. When bound, MutS alpha bends the DNA helix and shields approximately 20 base pairs, and recognizes single base mismatches and dinucleotide insertion-deletion loops (IDL) in the DNA. After mismatch binding, forms a ternary complex with the MutL alpha heterodimer, which is thought to be responsible for directing the downstream MMR events, including strand discrimination, excision, and resynthesis. ATP binding and hydrolysis play a pivotal role in mismatch repair functions. The ATPase activity associated with MutS alpha regulates binding similar to a molecular switch: mismatched DNA provokes ADP-->ATP exchange, resulting in a discernible conformational transition that converts MutS alpha into a sliding clamp capable of hydrolysis-independent diffusion along the DNA backbone. This transition is crucial for mismatch repair. MutS alpha may also play a role in DNA homologous recombination repair. Heterodimer consisting of MSH2-MSH6 (MutS alpha). Forms a ternary complex with MutL alpha (MLH1-PMS1). Interacts with EXO1. Part of the BRCA1-associated genome surveillance complex (BASC), which contains BRCA1, MSH2, MSH6, MLH1, ATM, BLM, PMS2 and the RAD50-MRE11-NBS1 protein complex. This association could be a dynamic process changing throughout the cell cycle and within subnuclear domains. Interacts with ATR. Belongs to the DNA mismatch repair MutS family. 2 isoforms of the human protein are produced by alternative splicing.

Protein type: DNA-binding

Chromosomal Location of Human Ortholog: 2p16

Cellular Component: cytoplasm; Golgi apparatus; intracellular membrane-bound organelle; MutSalpha complex; nuclear chromosome; nucleoplasm; plasma membrane

Molecular Function: ADP binding; ATP binding; ATPase activity; double-stranded DNA binding; four-way junction DNA binding; guanine/thymine mispair binding; magnesium ion binding; methylated histone residue binding; mismatched DNA binding; MutLalpha complex binding; oxidized purine DNA binding; protein binding; protein homodimerization activity; single guanine insertion binding; single thymine insertion binding

Biological Process: determination of adult life span; DNA damage response, signal transduction resulting in induction of apoptosis; DNA repair; isotype switching; maintenance of DNA repeat elements; meiotic mismatch repair; meiotic recombination; mismatch repair; negative regulation of DNA recombination; positive regulation of helicase activity; response to UV; somatic hypermutation of immunoglobulin genes; somatic recombination of immunoglobulin gene segments

Disease: Colorectal Cancer, Hereditary Nonpolyposis, Type 5; Endometrial Cancer; Mismatch Repair Cancer Syndrome

Research Articles on MSH6

Similar Products

Product Notes

The MSH6 msh6 (Catalog #AAA1277034) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgtcgcgac agagcaccct gtacagcttc ttccccaagt ctccggcgct gagtgatgcc aacaaggcct cggccagggc ctcacgcgaa ggcggccgtg ccgccgctgc ccccggggcc tctccttccc caggcgggga tgcggcctgg agcgaggctg ggcctgggcc caggcccttg gcgcgatccg cgtcaccgcc caaggcgaag aacctcaacg gagggctgcg gagatcggta gcgcctgctg cccccaccag ttgtgacttc tcaccgggag atttggtttg ggccaagatg gagggttacc cctggtggcc ttgtctggtt tacaaccacc cctttgatgg aacattcatc cgcgagaaag ggaaatcagt ccgtgttcat gtacagtttt ttgatgacag cccaacaagg ggctgggtta gcaaaaggct tttaaagcca tatacaggtt caaaatcaaa ggaagcccag aagggaggtc atttttacag tgcaaagcct gaaatactga gagcaatgca acgtgcagac gaagccttaa ataaagacaa gattaagagg cttgaattgg cagtttgtga tgagccctca gagccagaag aggaagaaga gatggaggta ggcacaactt acgtaacaga taagagtgaa gaagataatg aaattgagag tgaagaggaa gtacagccta agacacaagg atctaggcga agtagccgcc aaataaaaaa acgaagggtc atatcagatt ctgagagtga cattggtggc tctgatgtgg aatttaagcc agacactaag gaggaaggaa gcagtgatga aataagcagt ggagtggggg atagtgagag tgaaggcctg aacagccctg tcaaagttgc tcgaaagcgg aagagaatgg tgactggaaa tggctctctt aaaaggaaaa gctctaggaa ggaaacgccc tcagccacca aacaagcaac tagcatttca tcagaaacca agaatacttt gagagctttc tctgcccctc aaaattctga atcccaagcc cacgttagtg gaggtggtga tgacagtagt cgccctactg tttggtatca tgaaacttta gaatggctta aggaggaaaa gagaagagat gagcacagga ggaggcctga tcaccccgat tttgatgcat ctacactcta tgtgcctgag gatttcctca attcttgtac tcctgggatg aggaagtggt ggcagattaa gtctcagaac tttgatcttg tcatctgtta caaggtgggg aaattttatg agctgtacca catggatgct cttattggag tcagtgaact ggggctggta ttcatgaaag gcaactgggc ccattctggc tttcctgaaa ttgcatttgg ccgttattca gattccctgg tgcagaaggg ctataaagta gcacgagtgg aacagactga gactccagaa atgatggagg cacgatgtag aaagatggca catatatcca agtatgatag agtggtgagg agggagatct gtaggatcat taccaagggt acacagactt acagtgtgct ggaaggtgat ccctctgaga actacagtaa gtatcttctt agcctcaaag aaaaagagga agattcttct ggccatactc gtgcatatgg tgtgtgcttt gttgatactt cactgggaaa gtttttcata ggtcagtttt cagatgatcg ccattgttcg agatttagga ctctagtggc acactatccc ccagtacaag ttttatttga aaaaggaaat ctctcaaagg aaactaaaac aattctaaag agttcattgt cctgttctct tcaggaaggt ctgatacccg gctcccagtt ttgggatgca tccaaaactt tgagaactct ccttgaggaa gaatatttta gggaaaagct aagtgatggc attggggtga tgttacccca ggtgcttaaa ggtatgactt cagagtctga ttccattggg ttgacaccag gagagaaaag tgaattggcc ctctctgctc taggtggttg tgtcttctac ctcaaaaaat gccttattga tcaggagctt ttatcaatgg ctaattttga agaatatatt cccttggatt ctgacacagt cagcactaca agatctggtg ctatcttcac caaagcctat caacgaatgg tgctagatgc agtgacatta aacaacttgg agatttttct gaatggaaca aatggttcta ctgaaggaac cctactagag agggttgata cttgccatac tccttttggt aagcggctcc taaagcaatg gctttgtgcc ccactctgta accattatgc tattaatgat cgtctagatg ccatagaaga cctcatggtt gtgcctgaca aaatctccga agttgtagag cttctaaaga agcttccaga tcttgagagg ctactcagta aaattcataa tgttgggtct cccctgaaga gtcagaacca cccagacagc agggctataa tgtatgaaga aactacatac agcaagaaga agattattga ttttctttct gctctggaag gattcaaagt aatgtgtaaa attataggga tcatggaaga agttgctgat ggttttaagt ctaaaatcct taagcaggtc atctctctgc agacaaaaaa tcctgaaggt cgttttcctg atttgactgt agaattgaac cgatgggata cagcctttga ccatgaaaag gctcgaaaga ctggacttat tactcccaaa gcaggctttg actctgatta tgaccaagct cttgctgaca taagagaaaa tgaacagagc ctcctggaat acctagagaa acagcgcaac agaattggct gtaggaccat agtctattgg gggattggta ggaaccgtta ccagctggaa attcctgaga atttcaccac tcgcaatttg ccagaagaat acgagttgaa atctaccaag aagggctgta aacgatactg gaccaaaact attgaaaaga agttggctaa tctcataaat gctgaagaac ggagggatgt atcattgaag gactgcatgc ggcgactgtt ctataacttt gataaaaatt acaaggactg gcagtctgct gtagagtgta tcgcagtgtt ggatgtttta ctgtgcctgg ctaactatag tcgagggggt gatggtccta tgtgtcgccc agtaattctg ttgccggaag ataccccccc cttcttagag cttaaaggat cacgccatcc ttgcattacg aagacttttt ttggagatga ttttattcct aatgacattc taataggctg tgaggaagag gagcaggaaa atggcaaagc ctattgtgtg cttgttactg gaccaaatat ggggggcaag tctacgctta tgagacaggc tggcttatta gctgtaatgg cccagatggg ttgttacgtc cctgctgaag tgtgcaggct cacaccaatt gatagagtgt ttactagact tggtgcctca gacagaataa tgtcaggtga aagtacattt tttgttgaat taagtgaaac tgccagcata ctcatgcatg caacagcaca ttctctggtg cttgtggatg aattaggaag aggtactgca acatttgatg ggacggcaat agcaaatgca gttgttaaag aacttgctga gactataaaa tgtcgtacat tattttcaac tcactaccat tcattagtag aagattattc tcaaaatgtt gctgtgcgcc taggacatat ggcatgcatg gtagaaaatg aatgtgaaga ccccagccag gagactatta cgttcctcta taaattcatt aagggagctt gtcctaaaag ctatggcttt aatgcagcaa ggcttgctaa tctcccagag gaagttattc aaaagggaca tagaaaagca agagaatttg agaagatgaa tcagtcacta cgattatttc gggaagtttg cctggctagt gaaaggtcaa ctgtagatgc tgaagctgtc cataaattgc tgactttgat taaggaatta tag. It is sometimes possible for the material contained within the vial of "MSH6, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.