Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

MSH2 cdna clone

MSH2 cDNA Clone

Gene Names
MSH2; FCC1; COCA1; HNPCC; LCFS2; HNPCC1
Synonyms
MSH2; MSH2 cDNA Clone; MSH2 cdna clone
Ordering
For Research Use Only!
Sequence
atggcggtgcagccgaaggagacgctgcagttggagagcgcggccgaggtcggcttcgtgcgcttctttcagggcatgccggagaagccgaccaccacagtgcgccttttcgaccggggcgacttctatacggcgcacggcgaggacgcgctgctggccgcccgggaggtgttcaagacccagggggtgatcaagtacatggggccggcaggagcaaagaatctgcagagtgttgtgcttagtaaaatgaattttgaatcttttgtaaaagatcttcttctggttcgtcagtatagagttgaagtttataagaatagagctggaaataaggcatccaaggagaatgattggtatttggcatataaggcttctcctggcaatctctctcagtttgaagacattctctttggtaacaatgatatgtcagcttccattggtgttgtgggtgttaaaatgtccgcagttgatggccagagacaggttggagttgggtatgtggattccatacagaggaaactaggactgtgtgaattccctgataatgatcagttctccaatcttgaggctctcctcatccagattggaccaaaggaatgtgttttacccggaggagagactgctggagacatggggaaactgagacagataattcaaagaggaggaattctgatcacagaaagaaaaaaagctgacttttccacaaaagacatttatcaggacctcaaccggttgttgaaaggcaaaaagggagagcagatgaatagtgctgtattgccagaaatggagaatcaggttgcagtttcatcactgtctgcggtaatcaagtttttagaactcttatcagatgattccaactttggacagtttgaactgactacttttgacttcagccagtatatgaaattggatattgcagcagtcagagcccttaacctttttcagggttctgttgaagataccactggctctcagtctctggctgccttgctgaataagtgtaaaacccctcaaggacaaagacttgttaaccagtggattaagcagcctctcatggataagaacagaatagaggagagattgaatttagtggaagcttttgtagaagatgcagaattgaggcagactttacaagaagatttacttcgtcgattcccagatcttaaccgacttgccaagaagtttcaaagacaagcagcaaacttacaagattgttaccgactctatcagggtataaatcaactacctaatgttatacaggctctggaaaaacatgaaggaaaacaccagaaattattgttggcagtttttgtgactcctcttactgatcttcgttctgacttctccaagtttcaggaaatgatagaaacaactttagatatggatcaggtggaaaaccatgaattccttgtaaaaccttcatttgatcctaatctcagtgaattaagagaaataatgaatgacttggaaaagaagatgcagtcaacattaataagtgcagccagagatcttggcttggaccctggcaaacagattaaactggattccagtgcacagtttggatattactttcgtgtaacctgtaaggaagaaaaagtccttcgtaacaataaaaactttagtactgtagatatccagaagaatggtgttaaatttaccaacagcaaattgacttctttaaatgaagagtataccaaaaataaaacagaatatgaagaagcccaggatgccattgttaaagaaattgtcaatatttcttcaggctatgtagaaccaatgcagacactcaatgatgtgttagctcagctagatgctgttgtcagctttgctcacgtgtcaaatggagcacctgttccatatgtacgaccagccattttggagaaaggacaaggaagaattatattaaaagcatccaggcatgcttgtgttgaagttcaagatgaaattgcatttattcctaatgacgtatactttgaaaaagataaacagatgttccacatcattactggccccaatatgggaggtaaatcaacatatattcgacaaactggggtgatagtactcatggcccaaattgggtgttttgtgccatgtgagtcagcagaagtgtccattgtggactgcatcttagcccgagtaggggctggtgacagtcaattgaaaggagtctccacgttcatggctgaaatgttggaaactgcttctatcctcaggtctgcaaccaaagattcattaataatcatagatgaattgggaagaggaacttctacctacgatggatttgggttagcatgggctatatcagaatacattgcaacaaagattggtgctttttgcatgtttgcaacccattttcatgaacttactgccttggccaatcagataccaactgttaataatctacatgtcacagcactcaccactgaagagaccttaactatgctttatcaggtgaagaaaggtgtctgtgatcaaagttttgggattcatgttgcagagcttgctaatttccctaagcatgtaatagagtgtgctaaacagaaagccctggaacttgaggagtttcagtatattggagaatcgcaaggatatgatatcatggaaccagcagcaaagaagtgctatctggaaagagagcaaggtgaaaaaattattcaggagttcctgtccaaggtgaaacaaatgccctttactgaaatgtcagaagaaaacatcacaataaagttaaaacagctaaaagctgaagtaatagcaaagaataatagctttgtaaatgaaatcatttcacgaataaaagttactacgtga
Sequence Length
2805
Vector
pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
97,323 Da
NCBI Official Full Name
Homo sapiens mutS homolog 2, colon cancer, nonpolyposis type 1 (E. coli), mRNA
NCBI Official Synonym Full Names
mutS homolog 2
NCBI Official Symbol
MSH2
NCBI Official Synonym Symbols
FCC1; COCA1; HNPCC; LCFS2; HNPCC1
NCBI Protein Information
DNA mismatch repair protein Msh2
UniProt Protein Name
DNA mismatch repair protein Msh2
UniProt Gene Name
MSH2
UniProt Synonym Gene Names
hMSH2
UniProt Entry Name
MSH2_HUMAN

NCBI Description

This locus is frequently mutated in hereditary nonpolyposis colon cancer (HNPCC). When cloned, it was discovered to be a human homolog of the E. coli mismatch repair gene mutS, consistent with the characteristic alterations in microsatellite sequences (RER+ phenotype) found in HNPCC. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Apr 2012]

Uniprot Description

MSH2: Component of the post-replicative DNA mismatch repair system (MMR). Forms two different heterodimers: MutS alpha (MSH2- MSH6 heterodimer) and MutS beta (MSH2-MSH3 heterodimer) which binds to DNA mismatches thereby initiating DNA repair. When bound, heterodimers bend the DNA helix and shields approximately 20 base pairs. MutS alpha recognizes single base mismatches and dinucleotide insertion-deletion loops (IDL) in the DNA. MutS beta recognizes larger insertion-deletion loops up to 13 nucleotides long. After mismatch binding, MutS alpha or beta forms a ternary complex with the MutL alpha heterodimer, which is thought to be responsible for directing the downstream MMR events, including strand discrimination, excision, and resynthesis. ATP binding and hydrolysis play a pivotal role in mismatch repair functions. The ATPase activity associated with MutS alpha regulates binding similar to a molecular switch: mismatched DNA provokes ADP-->ATP exchange, resulting in a discernible conformational transition that converts MutS alpha into a sliding clamp capable of hydrolysis-independent diffusion along the DNA backbone. This transition is crucial for mismatch repair. MutS alpha may also play a role in DNA homologous recombination repair. In melanocytes may modulate both UV-B-induced cell cycle regulation and apoptosis. Heterodimer consisting of MSH2-MSH6 (MutS alpha) or MSH2- MSH3 (MutS beta). Both heterodimer form a ternary complex with MutL alpha (MLH1-PMS1). Interacts with EXO1. Part of the BRCA1- associated genome surveillance complex (BASC), which contains BRCA1, MSH2, MSH6, MLH1, ATM, BLM, PMS2 and the RAD50-MRE11-NBS1 protein complex. This association could be a dynamic process changing throughout the cell cycle and within subnuclear domains. Interacts with ATR. Interacts with SLX4/BTBD12; this interaction is direct and links MutS beta to SLX4, a subunit of different structure-specific endonucleases. Interacts with SMARCAD1. Ubiquitously expressed. Belongs to the DNA mismatch repair MutS family.

Protein type: DNA-binding; Tumor suppressor

Chromosomal Location of Human Ortholog: 2p21

Cellular Component: membrane; MutSalpha complex; MutSbeta complex; nuclear chromosome, telomeric region; nucleoplasm

Molecular Function: ADP binding; ATP binding; ATPase activity; dinucleotide insertion or deletion binding; dinucleotide repeat insertion binding; DNA binding; double-strand/single-strand DNA junction binding; double-stranded DNA binding; enzyme binding; four-way junction DNA binding; guanine/thymine mispair binding; loop DNA binding; magnesium ion binding; mismatched DNA binding; MutLalpha complex binding; oxidized purine DNA binding; protein binding; protein C-terminus binding; protein homodimerization activity; protein kinase binding; single guanine insertion binding; single thymine insertion binding; single-stranded DNA binding; Y-form DNA binding

Biological Process: B cell differentiation; B cell mediated immunity; DNA damage response, signal transduction by p53 class mediator resulting in induction of apoptosis; DNA repair; double-strand break repair; intra-S DNA damage checkpoint; isotype switching; maintenance of DNA repeat elements; male gonad development; meiotic gene conversion; meiotic mismatch repair; meiotic recombination; mismatch repair; negative regulation of DNA recombination; negative regulation of meiotic recombination; negative regulation of neuron apoptosis; positive regulation of helicase activity; postreplication repair; response to UV-B; response to X-ray; somatic hypermutation of immunoglobulin genes; somatic recombination of immunoglobulin gene segments

Disease: Lynch Syndrome I; Mismatch Repair Cancer Syndrome; Muir-torre Syndrome

Research Articles on MSH2

Similar Products

Product Notes

The MSH2 msh2 (Catalog #AAA1275588) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggcggtgc agccgaagga gacgctgcag ttggagagcg cggccgaggt cggcttcgtg cgcttctttc agggcatgcc ggagaagccg accaccacag tgcgcctttt cgaccggggc gacttctata cggcgcacgg cgaggacgcg ctgctggccg cccgggaggt gttcaagacc cagggggtga tcaagtacat ggggccggca ggagcaaaga atctgcagag tgttgtgctt agtaaaatga attttgaatc ttttgtaaaa gatcttcttc tggttcgtca gtatagagtt gaagtttata agaatagagc tggaaataag gcatccaagg agaatgattg gtatttggca tataaggctt ctcctggcaa tctctctcag tttgaagaca ttctctttgg taacaatgat atgtcagctt ccattggtgt tgtgggtgtt aaaatgtccg cagttgatgg ccagagacag gttggagttg ggtatgtgga ttccatacag aggaaactag gactgtgtga attccctgat aatgatcagt tctccaatct tgaggctctc ctcatccaga ttggaccaaa ggaatgtgtt ttacccggag gagagactgc tggagacatg gggaaactga gacagataat tcaaagagga ggaattctga tcacagaaag aaaaaaagct gacttttcca caaaagacat ttatcaggac ctcaaccggt tgttgaaagg caaaaaggga gagcagatga atagtgctgt attgccagaa atggagaatc aggttgcagt ttcatcactg tctgcggtaa tcaagttttt agaactctta tcagatgatt ccaactttgg acagtttgaa ctgactactt ttgacttcag ccagtatatg aaattggata ttgcagcagt cagagccctt aacctttttc agggttctgt tgaagatacc actggctctc agtctctggc tgccttgctg aataagtgta aaacccctca aggacaaaga cttgttaacc agtggattaa gcagcctctc atggataaga acagaataga ggagagattg aatttagtgg aagcttttgt agaagatgca gaattgaggc agactttaca agaagattta cttcgtcgat tcccagatct taaccgactt gccaagaagt ttcaaagaca agcagcaaac ttacaagatt gttaccgact ctatcagggt ataaatcaac tacctaatgt tatacaggct ctggaaaaac atgaaggaaa acaccagaaa ttattgttgg cagtttttgt gactcctctt actgatcttc gttctgactt ctccaagttt caggaaatga tagaaacaac tttagatatg gatcaggtgg aaaaccatga attccttgta aaaccttcat ttgatcctaa tctcagtgaa ttaagagaaa taatgaatga cttggaaaag aagatgcagt caacattaat aagtgcagcc agagatcttg gcttggaccc tggcaaacag attaaactgg attccagtgc acagtttgga tattactttc gtgtaacctg taaggaagaa aaagtccttc gtaacaataa aaactttagt actgtagata tccagaagaa tggtgttaaa tttaccaaca gcaaattgac ttctttaaat gaagagtata ccaaaaataa aacagaatat gaagaagccc aggatgccat tgttaaagaa attgtcaata tttcttcagg ctatgtagaa ccaatgcaga cactcaatga tgtgttagct cagctagatg ctgttgtcag ctttgctcac gtgtcaaatg gagcacctgt tccatatgta cgaccagcca ttttggagaa aggacaagga agaattatat taaaagcatc caggcatgct tgtgttgaag ttcaagatga aattgcattt attcctaatg acgtatactt tgaaaaagat aaacagatgt tccacatcat tactggcccc aatatgggag gtaaatcaac atatattcga caaactgggg tgatagtact catggcccaa attgggtgtt ttgtgccatg tgagtcagca gaagtgtcca ttgtggactg catcttagcc cgagtagggg ctggtgacag tcaattgaaa ggagtctcca cgttcatggc tgaaatgttg gaaactgctt ctatcctcag gtctgcaacc aaagattcat taataatcat agatgaattg ggaagaggaa cttctaccta cgatggattt gggttagcat gggctatatc agaatacatt gcaacaaaga ttggtgcttt ttgcatgttt gcaacccatt ttcatgaact tactgccttg gccaatcaga taccaactgt taataatcta catgtcacag cactcaccac tgaagagacc ttaactatgc tttatcaggt gaagaaaggt gtctgtgatc aaagttttgg gattcatgtt gcagagcttg ctaatttccc taagcatgta atagagtgtg ctaaacagaa agccctggaa cttgaggagt ttcagtatat tggagaatcg caaggatatg atatcatgga accagcagca aagaagtgct atctggaaag agagcaaggt gaaaaaatta ttcaggagtt cctgtccaag gtgaaacaaa tgccctttac tgaaatgtca gaagaaaaca tcacaataaa gttaaaacag ctaaaagctg aagtaatagc aaagaataat agctttgtaa atgaaatcat ttcacgaata aaagttacta cgtga. It is sometimes possible for the material contained within the vial of "MSH2, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.