Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

MRPS25 cdna clone

MRPS25

Gene Names
MRPS25; RPMS25; MRP-S25
Synonyms
MRPS25; MRP-S25; RPMS25; S25mt; MRPS25 cdna clone
Ordering
For Research Use Only!
Form/Format
Lyophilized
Sequence
Nucleotide Sequence: ATGCCCATGAAGGGCCGCTTCCCCATCCGCCGCACCCTGCAATATCTGAGCCAGGGGAACGTGGTGTTCAAGGACTCCGTGAAGGTCATGACAGTGAATTACAACACGCATGGGGAGCTGGGCGAGGGCGCCAGGAAGTTTGTGTTTTTCAACATACCTCAGATTCAATACAAAAACCCTTGGGTGCAGATCATGATGTTTAAGAACATGACGCCGTCACCCTTCCTGCGATTCTACTTAGATTCTGGGGAGCAGGTCCTGGTGGATGTGGAGACCAAGAGCAATAAGGAGATCATGGAGCACATCAGAAAAATCTTGGGGAAGAATGAGGAAACCCTCAGGGAAGAGGAGGAGGAGAAAAAGCAGCTTTCTCACCCAGCCAACTTCGGCCCTCGAAAGTACTGCCTGCGGGAGTGCATCTGTGAAGTGGAAGGGCAGGTGCCCTGCCCCAGCCTGGTGCCATTACCCAAGGAGATGAGGGGGAAGTACAAAGCCGCTCTGAAAGCCGATGCCCAGGACTAA

Translation Sequence: MPMKGRFPIR RTLQYLSQGN VVFKDSVKVM TVNYNTHGEL GEGARKFVFF NIPQIQYKNP WVQIMMFKNM TPSPFLRFYL DSGEQVLVDV ETKSNKEIME HIRKILGKNE ETLREEEEEK KQLSHPANFG PRKYCLRECI CEVEGQVPCP SLVPLPKEMR GKYKAALKAD AQD
Sequence Length
173
Species
Human
Chromosome Location
3p25
OMIM Reference Number
611987
cDNA Size
522bp
Vector Description
This shuttle vector contains the complete ORF. It is inseted BamH I to Xho I. The gene insert contains multiple cloning sites which can be used to easily cut and transfer the gene and recombination site into your expression vector.
Vector
(puc19-derived cloning vector)
Preparation Before Usage
1. Centrifuge at 7000rpm for 1 minute. 2. Carefully open the vial and add 100ul of sterile water to dissolve the DNA. Each tube contains approximately 10ug of lyophilized plasmid.
Preparation and Storage
Store the plasmid at -20 degree C.
Related Product Information for MRPS25 cdna clone
MRP-S25 (mitochondrial 28S ribosomal protein S25), also known as S25mt, is a 173 amino acid mitochondrial ribosomal protein belonging to the ribosomal protein S25/L51 family. Localized to mitochondria, MRP-S25 is present in the 28S subunit of the mitoribosomes.
Product Categories/Family for MRPS25 cdna clone

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
NCBI Accession #
NCBI GenBank Nucleotide #
UniProt Accession #
NCBI Official Full Name
28S ribosomal protein S25, mitochondrial
NCBI Official Synonym Full Names
mitochondrial ribosomal protein S25
NCBI Official Symbol
MRPS25
NCBI Official Synonym Symbols
RPMS25; MRP-S25
NCBI Protein Information
28S ribosomal protein S25, mitochondrial
UniProt Protein Name
28S ribosomal protein S25, mitochondrial
Protein Family
UniProt Gene Name
MRPS25
UniProt Synonym Gene Names
RPMS25; MRP-S25; S25mt
UniProt Entry Name
RT25_HUMAN

NCBI Description

Mammalian mitochondrial ribosomal proteins are encoded by nuclear genes and help in protein synthesis within the mitochondrion. Mitochondrial ribosomes (mitoribosomes) consist of a small 28S subunit and a large 39S subunit. They have an estimated 75% protein to rRNA composition compared to prokaryotic ribosomes, where this ratio is reversed. Another difference between mammalian mitoribosomes and prokaryotic ribosomes is that the latter contain a 5S rRNA. Among different species, the proteins comprising the mitoribosome differ greatly in sequence, and sometimes in biochemical properties, which prevents easy recognition by sequence homology. This gene encodes a 28S subunit protein. A pseudogene corresponding to this gene is found on chromosome 4. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Feb 2016]

Uniprot Description

MRPS25: a mitochondrial ribosomal protein encoded by a nuclear gene that helps in protein synthesis within the mitochondrion. Mitochondrial ribosomes (mitoribosomes) consist of a small 28S subunit and a large 39S subunit. They have an estimated 75% protein to rRNA composition compared to prokaryotic ribosomes, where this ratio is reversed. Another difference between mammalian mitoribosomes and prokaryotic ribosomes is that the latter contain a 5S rRNA. Among different species, the proteins comprising the mitoribosome differ greatly in sequence, and sometimes in biochemical properties, which prevents easy recognition by sequence homology. This gene encodes a 28S subunit protein. A pseudogene corresponding to this gene is found on chromosome 4. [provided by RefSeq, Jul 2008]

Protein type: Mitochondrial

Chromosomal Location of Human Ortholog: 3p25

Cellular Component: mitochondrion; mitochondrial inner membrane; ribosome

Biological Process: mitochondrial translation; organelle organization and biogenesis

Research Articles on MRPS25

Similar Products

Product Notes

The MRPS25 mrps25 (Catalog #AAA200912) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: Nucleotide Sequence: ATGCCCATGA AGGGCCGCTT CCCCATCCGC CGCACCCTGC AATATCTGAG CCAGGGGAAC GTGGTGTTCA AGGACTCCGT GAAGGTCATG ACAGTGAATT ACAACACGCA TGGGGAGCTG GGCGAGGGCG CCAGGAAGTT TGTGTTTTTC AACATACCTC AGATTCAATA CAAAAACCCT TGGGTGCAGA TCATGATGTT TAAGAACATG ACGCCGTCAC CCTTCCTGCG ATTCTACTTA GATTCTGGGG AGCAGGTCCT GGTGGATGTG GAGACCAAGA GCAATAAGGA GATCATGGAG CACATCAGAA AAATCTTGGG GAAGAATGAG GAAACCCTCA GGGAAGAGGA GGAGGAGAAA AAGCAGCTTT CTCACCCAGC CAACTTCGGC CCTCGAAAGT ACTGCCTGCG GGAGTGCATC TGTGAAGTGG AAGGGCAGGT GCCCTGCCCC AGCCTGGTGC CATTACCCAA GGAGATGAGG GGGAAGTACA AAGCCGCTCT GAAAGCCGAT GCCCAGGACT AA Translatio n Sequence: MPMKGRFPIR RTLQYLSQGN VVFKDSVKVM TVNYNTHGEL GEGARKFVFF NIPQIQYKNP WVQIMMFKNM TPSPFLRFYL DSGEQVLVDV ETKSNKEIME HIRKILGKNE ETLREEEEEK KQLSHPANFG PRKYCLRECI CEVEGQVPCP SLVPLPKEMR GKYKAALKAD AQD. It is sometimes possible for the material contained within the vial of "MRPS25, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.