Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

MRPL46 cdna clone

MRPL46 cDNA Clone

Gene Names
MRPL46; LIECG2; P2ECSL; C15orf4
Synonyms
MRPL46; MRPL46 cDNA Clone; MRPL46 cdna clone
Ordering
For Research Use Only!
Sequence
atggcggcgcccgtaaggcggacgctgttaggggtggcggggggttggcggcggttcgagaggctctgggccggcagtctaagctctcgcagcctggctcttgcagccgcaccctcaagcaacggatccccatggcgcttgttgggcgcgttgtgcctgcagcggccacctgtagtctccaagccgttgaccccattgcaggaagagatggcgtctctactgcagcagattgagatagagagaagcctgtattcagaccacgagcttcgtgctctggatgaaaaccagcgactggcaaagaagaaagctgaccttcatgatgaagaagatgaacaggatatattgctggcgcaagatttggaagatatgtgggagcagaaatttctacagttcaaacttggagctcgcataacagaagctgatgaaaagaatgaccgaacatccctgaacaggaagctagacaggaaccttgtcctgttagtcagagagaagtttggagaccaggatgtttggatactgccccaggcagagtggcagcctggggagacccttcgaggaacagctgaacgaactctggccacactctcagaaaacaacatggaagccaagttcctaggaaatgcaccctgtgggcactacacattcaagttcccccaggcaatgcggacagagagtaacctcggagccaaggtgttcttcttcaaagcactgctattaactggagacttttcccaggctgggaataagggccatcatgtgtgggtcactaaggatgagctgggtgactatttgaaaccaaaatacctggcccaagttaggaggtttgtttcagacctctga
Sequence Length
840
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
31,705 Da
NCBI Official Full Name
Homo sapiens mitochondrial ribosomal protein L46, mRNA
NCBI Official Synonym Full Names
mitochondrial ribosomal protein L46
NCBI Official Symbol
MRPL46
NCBI Official Synonym Symbols
LIECG2; P2ECSL; C15orf4
NCBI Protein Information
39S ribosomal protein L46, mitochondrial
UniProt Protein Name
39S ribosomal protein L46, mitochondrial
Protein Family
UniProt Gene Name
MRPL46
UniProt Synonym Gene Names
C15orf4; LIECG2; L46mt; MRP-L46
UniProt Entry Name
RM46_HUMAN

NCBI Description

Mammalian mitochondrial ribosomal proteins are encoded by nuclear genes and help in protein synthesis within the mitochondrion. Mitochondrial ribosomes (mitoribosomes) consist of a small 28S subunit and a large 39S subunit. They have an estimated 75% protein to rRNA composition compared to prokaryotic ribosomes, where this ratio is reversed. Another difference between mammalian mitoribosomes and prokaryotic ribosomes is that the latter contain a 5S rRNA. Among different species, the proteins comprising the mitoribosome differ greatly in sequence, and sometimes in biochemical properties, which prevents easy recognition by sequence homology. This gene encodes a 39S subunit protein. [provided by RefSeq, Jul 2008]

Uniprot Description

MRPL46: a mitochondrial ribosomal protein encoded by a nuclear gene that helps in protein synthesis within the mitochondrion. Mitochondrial ribosomes (mitoribosomes) consist of a small 28S subunit and a large 39S subunit. They have an estimated 75% protein to rRNA composition compared to prokaryotic ribosomes, where this ratio is reversed. Another difference between mammalian mitoribosomes and prokaryotic ribosomes is that the latter contain a 5S rRNA. Among different species, the proteins comprising the mitoribosome differ greatly in sequence, and sometimes in biochemical properties, which prevents easy recognition by sequence homology. This gene encodes a 39S subunit protein. [provided by RefSeq, Jul 2008]

Protein type: Mitochondrial; Ribosomal; Translation

Chromosomal Location of Human Ortholog: 15q25.3

Cellular Component: cell junction; mitochondrial inner membrane; mitochondrial large ribosomal subunit; mitochondrion; nucleoplasm

Molecular Function: structural constituent of ribosome

Research Articles on MRPL46

Similar Products

Product Notes

The MRPL46 mrpl46 (Catalog #AAA1269797) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggcggcgc ccgtaaggcg gacgctgtta ggggtggcgg ggggttggcg gcggttcgag aggctctggg ccggcagtct aagctctcgc agcctggctc ttgcagccgc accctcaagc aacggatccc catggcgctt gttgggcgcg ttgtgcctgc agcggccacc tgtagtctcc aagccgttga ccccattgca ggaagagatg gcgtctctac tgcagcagat tgagatagag agaagcctgt attcagacca cgagcttcgt gctctggatg aaaaccagcg actggcaaag aagaaagctg accttcatga tgaagaagat gaacaggata tattgctggc gcaagatttg gaagatatgt gggagcagaa atttctacag ttcaaacttg gagctcgcat aacagaagct gatgaaaaga atgaccgaac atccctgaac aggaagctag acaggaacct tgtcctgtta gtcagagaga agtttggaga ccaggatgtt tggatactgc cccaggcaga gtggcagcct ggggagaccc ttcgaggaac agctgaacga actctggcca cactctcaga aaacaacatg gaagccaagt tcctaggaaa tgcaccctgt gggcactaca cattcaagtt cccccaggca atgcggacag agagtaacct cggagccaag gtgttcttct tcaaagcact gctattaact ggagactttt cccaggctgg gaataagggc catcatgtgt gggtcactaa ggatgagctg ggtgactatt tgaaaccaaa atacctggcc caagttagga ggtttgtttc agacctctga. It is sometimes possible for the material contained within the vial of "MRPL46, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.