Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

MLPH cdna clone

MLPH cDNA Clone

Gene Names
MLPH; SLAC2-A
Synonyms
MLPH; MLPH cDNA Clone; MLPH cdna clone
Ordering
For Research Use Only!
Sequence
atggggaagaaactggatctttccaagctcactgatgaagaggcccagcatgtcttggaagttgttcaacgagattttgacctccgaaggaaagaagaggaacggctagaggcgttgaagggcaagattaagaaggaaagctccaagagggagctgctttccgacactgcccatctgaacgagacccactgcgcccgctgcctgcagccctaccagctgcttgtgaatagcaaaaggcagtgcctggaatgtggcctcttcacctgcaaaagctgtggccgcgtccacccggaggagcagggctggatctgtgacccctgccatctggccagagtcgtgaagatcggctcactggagtggtactatgagcatgtgaaagcccgcttcaagaggttcggaagtgccaaggtcatccggtccctccacgggcggctgcagggtggagctgggcctgaactgatatctgaagagagaagtggagacagcgaccagacagatgaggatggagaacctggctcagaggcccaggcccaggcccagccctttggcagcaaaaaaaagcgcctcctctccgtccacgacttcgacttcgagggagactcagatgactccactcagcctcaaggtcactccctgcacctgtcctcagtccctgaggccagggacagcccacagtccctcacagatgagtcctgctcagagaaggcagcccctcacaaggctgagggcctggaggaggctgatactggggcctctgggtgccactcccatccggaagagcagccgaccagcatctcaccttccagacacggcgccctggctgagctctgcccgcctggaggctcccacaggatggccctggggactgctgctgcactcgggtcgaatgtcatcaggaatgagcagctgcccctgcagtacttggccgatgtggacacctctgatgaggaaagcatccgggctcacgtgatggcctcccaccattccaagcggagaggccgggcgtcttctgagagtcagatctttgagctgaataagcatatttcagctgtggaatgcctgctgacctacctggagaacacagttgtgcctcccttggccaagggtctaggtgctggagtgcgcacggaggccgatgtagaggaggaggccctgaggaggaagctggaggagctgaccagcaacgtcagtgaccaggagacctcgtccgaggaggaggaagccaaggacgaaaaggcagagcccaacagggacaaatcagttgggcctctcccccaggcggacccggaggtgggcacggctgcccatcaaaccaacagacaggaaaaaagcccccaggaccctggggaccccgtccagtacaacaggaccacagatgaggagctgtcagagctggaggacagagtggcagtgacggcctcagaagtccagcaggcagagagcgaggtttcagacattgaatccaggattgcagccctgagggccgcagggctcacggtgaagccctcgggaaagccccggaggaagtcaaacctcccgatatttctccctcgagtggctgggaaacttggcaagagaccagaggacccaaatgcagacccttcaagtgaggccaaggcaatggctgtgccctatcttctgagaagaaagttcagtaattccctgaaaagtcaaggtaaagatgatgattcttttgatcggaaatcagtgtaccgaggctcgctgacacagagaaaccccaacgcgaggaaaggaatggccagccacaccttcgcgaaacctgtggtggcccaccagtcctaa
Sequence Length
1803
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
50,735 Da
NCBI Official Full Name
Homo sapiens melanophilin, mRNA
NCBI Official Synonym Full Names
melanophilin
NCBI Official Symbol
MLPH
NCBI Official Synonym Symbols
SLAC2-A
NCBI Protein Information
melanophilin
UniProt Protein Name
Melanophilin
Protein Family
UniProt Gene Name
MLPH
UniProt Synonym Gene Names
SLAC2A; SlaC2-a
UniProt Entry Name
MELPH_HUMAN

NCBI Description

This gene encodes a member of the exophilin subfamily of Rab effector proteins. The protein forms a ternary complex with the small Ras-related GTPase Rab27A in its GTP-bound form and the motor protein myosin Va. A similar protein complex in mouse functions to tether pigment-producing organelles called melanosomes to the actin cytoskeleton in melanocytes, and is required for visible pigmentation in the hair and skin. A mutation in this gene results in Griscelli syndrome type 3, which is characterized by a silver-gray hair color and abnormal pigment distribution in the hair shaft. Several alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2013]

Uniprot Description

MLPH: Rab effector protein involved in melanosome transport. Serves as link between melanosome-bound RAB27A and the motor protein MYO5A. Defects in MLPH are a cause of Griscelli syndrome type 3 (GS3). GS3 is a rare autosomal recessive disorder characterized by pigmentary dilution of the skin and hair, the presence of large clumps of pigment in hair shafts, and an accumulation of melanosomes in melanocytes, without other clinical manifestations. 3 isoforms of the human protein are produced by alternative splicing.

Protein type: Adaptor/scaffold

Chromosomal Location of Human Ortholog: 2q37.3

Cellular Component: dendrite; perinuclear region of cytoplasm

Molecular Function: protein binding; Rab GTPase binding

Disease: Griscelli Syndrome, Type 3

Research Articles on MLPH

Similar Products

Product Notes

The MLPH mlph (Catalog #AAA1269459) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggggaaga aactggatct ttccaagctc actgatgaag aggcccagca tgtcttggaa gttgttcaac gagattttga cctccgaagg aaagaagagg aacggctaga ggcgttgaag ggcaagatta agaaggaaag ctccaagagg gagctgcttt ccgacactgc ccatctgaac gagacccact gcgcccgctg cctgcagccc taccagctgc ttgtgaatag caaaaggcag tgcctggaat gtggcctctt cacctgcaaa agctgtggcc gcgtccaccc ggaggagcag ggctggatct gtgacccctg ccatctggcc agagtcgtga agatcggctc actggagtgg tactatgagc atgtgaaagc ccgcttcaag aggttcggaa gtgccaaggt catccggtcc ctccacgggc ggctgcaggg tggagctggg cctgaactga tatctgaaga gagaagtgga gacagcgacc agacagatga ggatggagaa cctggctcag aggcccaggc ccaggcccag ccctttggca gcaaaaaaaa gcgcctcctc tccgtccacg acttcgactt cgagggagac tcagatgact ccactcagcc tcaaggtcac tccctgcacc tgtcctcagt ccctgaggcc agggacagcc cacagtccct cacagatgag tcctgctcag agaaggcagc ccctcacaag gctgagggcc tggaggaggc tgatactggg gcctctgggt gccactccca tccggaagag cagccgacca gcatctcacc ttccagacac ggcgccctgg ctgagctctg cccgcctgga ggctcccaca ggatggccct ggggactgct gctgcactcg ggtcgaatgt catcaggaat gagcagctgc ccctgcagta cttggccgat gtggacacct ctgatgagga aagcatccgg gctcacgtga tggcctccca ccattccaag cggagaggcc gggcgtcttc tgagagtcag atctttgagc tgaataagca tatttcagct gtggaatgcc tgctgaccta cctggagaac acagttgtgc ctcccttggc caagggtcta ggtgctggag tgcgcacgga ggccgatgta gaggaggagg ccctgaggag gaagctggag gagctgacca gcaacgtcag tgaccaggag acctcgtccg aggaggagga agccaaggac gaaaaggcag agcccaacag ggacaaatca gttgggcctc tcccccaggc ggacccggag gtgggcacgg ctgcccatca aaccaacaga caggaaaaaa gcccccagga ccctggggac cccgtccagt acaacaggac cacagatgag gagctgtcag agctggagga cagagtggca gtgacggcct cagaagtcca gcaggcagag agcgaggttt cagacattga atccaggatt gcagccctga gggccgcagg gctcacggtg aagccctcgg gaaagccccg gaggaagtca aacctcccga tatttctccc tcgagtggct gggaaacttg gcaagagacc agaggaccca aatgcagacc cttcaagtga ggccaaggca atggctgtgc cctatcttct gagaagaaag ttcagtaatt ccctgaaaag tcaaggtaaa gatgatgatt cttttgatcg gaaatcagtg taccgaggct cgctgacaca gagaaacccc aacgcgagga aaggaatggc cagccacacc ttcgcgaaac ctgtggtggc ccaccagtcc taa. It is sometimes possible for the material contained within the vial of "MLPH, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.