Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

MINPP1 cdna clone

MINPP1 cDNA Clone

Gene Names
MINPP1; MIPP; HIPER1; MINPP2
Synonyms
MINPP1; MINPP1 cDNA Clone; MINPP1 cdna clone
Ordering
For Research Use Only!
Sequence
atgctacgcgcgcccggctgcctcctccggacctccgtagcgcctgccgcggccctggctgcggcgctgctctcgtcgcttgcgcgctgctctcttctagagccgagggacccggtggcctcgtcgctcagcccctatttcggcaccaagactcgctacgaggatgtcaaccccgtgctattgtcgggccccgaggctccgtggcgggaccctgagctgctggaggggacctgcaccccggtgcagctggtcgccctcattcgccacggcacccgctaccccacggtcaaacagatccgcaagctgaggcagctgcacgggttgctgcaggcccgcgggtccagggatggcggggctagtagtaccggcagccgcgacctgggtgcagcgctggccgactggcctttgtggtacgcggactggatggacgggcagctagtagagaagggacggcaggatatgcgacagctggcgctgcgtctggcctcgctcttcccggcccttttcagccgtgagaactacggccgcctgcggctcatcaccagttccaagcaccgctgcatggatagcagcgccgccttcctgcaggggctgtggcagcactaccaccctggcttgccgccgccggacgtcgcagatatggagtttggacctccaacagttaatgataaactaatgagattttttgatcactgtgagaagtttttaactgaagtagaaaaaaatgctacagctctttatcacgtggaagccttcaaaactggaccagaaatgcagaacattttaaaaaaagttgcagctactttgcaagtgccagtaaatgatttaaatgcagatttaattcaagtagcctttttcacctgttcatttgacctggcaattaaaggtgttaaatctccttggtgtgatgtttttgacatagatgatgcaaaggtattagaatatttaaatgatctgaaacaatattggaaaagaggatatgggtatactattaacagtcgatccagctgcaccttgtttcaggatatctttcagcacttggacaaagcagttgaacagaaacaaaggtctcagccaatttcttctccagtcatcctccagtttggtcatgcagagactcttcttccactgctttctctcatgggctacttcaaagacaaggaacccctaacagcgtacaattacaaaaaacaaatgcatcggaagttccgaagtggtctcattgtaccttatgcctcgaacctgatatttgtgctttaccactgtgaaaatgctaagactcctaaagaacaattccgagtgcagatgttattaaatgaaaaggtgttacctttggcttactcacaagaaactgtttcattttatgaagatctgaagaaccactacaaggacatccttcagagttgtcaaaccagtgaagaatgtgaattagcaagggctaacagtacatctgatgaactatga
Sequence Length
1464
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
33,100 Da
NCBI Official Full Name
Homo sapiens multiple inositol polyphosphate histidine phosphatase, 1, mRNA
NCBI Official Synonym Full Names
multiple inositol-polyphosphate phosphatase 1
NCBI Official Symbol
MINPP1
NCBI Official Synonym Symbols
MIPP; HIPER1; MINPP2
NCBI Protein Information
multiple inositol polyphosphate phosphatase 1
UniProt Protein Name
Multiple inositol polyphosphate phosphatase 1
UniProt Gene Name
MINPP1
UniProt Synonym Gene Names
MIPP; 2,3-BPG phosphatase; Ins(1,3,4,5)P(4) 3-phosphatase
UniProt Entry Name
MINP1_HUMAN

NCBI Description

This gene encodes multiple inositol polyphosphate phosphatase; an enzyme that removes 3-phosphate from inositol phosphate substrates. It is the only enzyme known to hydrolzye inositol pentakisphosphate and inositol hexakisphosphate. This enzyme also converts 2,3 bisphosphoglycerate (2,3-BPG) to 2-phosphoglycerate; an activity formerly thought to be exclusive to 2,3-BPG synthase/2-phosphatase (BPGM) in the Rapoport-Luebering shunt of the glycolytic pathway.[provided by RefSeq, Sep 2009]

Uniprot Description

MINPP1: Acts as a phosphoinositide 5- and phosphoinositide 6- phosphatase and regulates cellular levels of inositol pentakisphosphate (InsP5) and inositol hexakisphosphate (InsP6). Also acts as a 2,3-bisphosphoglycerate 3-phosphatase, by mediating the dephosphorylation of 2,3-bisphosphoglycerate (2,3-BPG) to produce phospho-D-glycerate without formation of 3- phosphoglycerate. May play a role in bone development (endochondral ossification). Defects in MINPP1 may be involved in follicular thyroid tumors development. Belongs to the histidine acid phosphatase family. MINPP1 subfamily. 3 isoforms of the human protein are produced by alternative splicing.

Protein type: Hydrolase; EC 3.1.3.62; Carbohydrate Metabolism - inositol phosphate; Secreted, signal peptide; Secreted; EC 3.1.3.80; Motility/polarity/chemotaxis

Chromosomal Location of Human Ortholog: 10q23

Cellular Component: endoplasmic reticulum; endoplasmic reticulum lumen

Molecular Function: inositol-1,3,4,5,6-pentakisphosphate 3-phosphatase activity; inositol-1,3,4,5-tetrakisphosphate 3-phosphatase activity; phosphohistidine phosphatase activity

Biological Process: inositol phosphate metabolic process; polyphosphate metabolic process

Disease: Thyroid Carcinoma, Follicular

Research Articles on MINPP1

Similar Products

Product Notes

The MINPP1 minpp1 (Catalog #AAA1277517) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgctacgcg cgcccggctg cctcctccgg acctccgtag cgcctgccgc ggccctggct gcggcgctgc tctcgtcgct tgcgcgctgc tctcttctag agccgaggga cccggtggcc tcgtcgctca gcccctattt cggcaccaag actcgctacg aggatgtcaa ccccgtgcta ttgtcgggcc ccgaggctcc gtggcgggac cctgagctgc tggaggggac ctgcaccccg gtgcagctgg tcgccctcat tcgccacggc acccgctacc ccacggtcaa acagatccgc aagctgaggc agctgcacgg gttgctgcag gcccgcgggt ccagggatgg cggggctagt agtaccggca gccgcgacct gggtgcagcg ctggccgact ggcctttgtg gtacgcggac tggatggacg ggcagctagt agagaaggga cggcaggata tgcgacagct ggcgctgcgt ctggcctcgc tcttcccggc ccttttcagc cgtgagaact acggccgcct gcggctcatc accagttcca agcaccgctg catggatagc agcgccgcct tcctgcaggg gctgtggcag cactaccacc ctggcttgcc gccgccggac gtcgcagata tggagtttgg acctccaaca gttaatgata aactaatgag attttttgat cactgtgaga agtttttaac tgaagtagaa aaaaatgcta cagctcttta tcacgtggaa gccttcaaaa ctggaccaga aatgcagaac attttaaaaa aagttgcagc tactttgcaa gtgccagtaa atgatttaaa tgcagattta attcaagtag cctttttcac ctgttcattt gacctggcaa ttaaaggtgt taaatctcct tggtgtgatg tttttgacat agatgatgca aaggtattag aatatttaaa tgatctgaaa caatattgga aaagaggata tgggtatact attaacagtc gatccagctg caccttgttt caggatatct ttcagcactt ggacaaagca gttgaacaga aacaaaggtc tcagccaatt tcttctccag tcatcctcca gtttggtcat gcagagactc ttcttccact gctttctctc atgggctact tcaaagacaa ggaaccccta acagcgtaca attacaaaaa acaaatgcat cggaagttcc gaagtggtct cattgtacct tatgcctcga acctgatatt tgtgctttac cactgtgaaa atgctaagac tcctaaagaa caattccgag tgcagatgtt attaaatgaa aaggtgttac ctttggctta ctcacaagaa actgtttcat tttatgaaga tctgaagaac cactacaagg acatccttca gagttgtcaa accagtgaag aatgtgaatt agcaagggct aacagtacat ctgatgaact atga. It is sometimes possible for the material contained within the vial of "MINPP1, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.