Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

MIF cdna clone

MIF cDNA Clone

Gene Names
MIF; GIF; GLIF; MMIF
Synonyms
MIF; MIF cDNA Clone; MIF cdna clone
Ordering
For Research Use Only!
Sequence
atgccgatgttcatcgtaaacaccaacgtgccccgcgcctccgtgccggacgggttcctctccgagctcacccagcagctggcgcaggccaccggcaagcccccccagtacatcgcggtgcacgtggtcccggaccagctcatggccttcggcggctccagcgagccgtgcgcgctctgcagcctgcacagcatcggcaagatcggcggcgcgcagaaccgctcctacagcaagctgctgtgcggcctgctggccgagcgcctgcgcatcagcccggacagggtctacatcaactattacgacatgaacgcggccaatgtgggctggaacaactccaccttcgcctaa
Sequence Length
348
Vector
pENTR223.1
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
12,476 Da
NCBI Official Full Name
Homo sapiens macrophage migration inhibitory factor (glycosylation-inhibiting factor), mRNA
NCBI Official Synonym Full Names
macrophage migration inhibitory factor (glycosylation-inhibiting factor)
NCBI Official Symbol
MIF
NCBI Official Synonym Symbols
GIF; GLIF; MMIF
NCBI Protein Information
macrophage migration inhibitory factor
UniProt Protein Name
Macrophage migration inhibitory factor
Protein Family
UniProt Gene Name
MIF
UniProt Synonym Gene Names
GLIF; MMIF; MIF; GIF
UniProt Entry Name
MIF_HUMAN

NCBI Description

This gene encodes a lymphokine involved in cell-mediated immunity, immunoregulation, and inflammation. It plays a role in the regulation of macrophage function in host defense through the suppression of anti-inflammatory effects of glucocorticoids. This lymphokine and the JAB1 protein form a complex in the cytosol near the peripheral plasma membrane, which may indicate an additional role in integrin signaling pathways. [provided by RefSeq, Jul 2008]

Uniprot Description

MIF: a lymphokine involved in cell-mediated immunity, immunoregulation, and inflammation. It plays a role in the regulation of macrophage function in host defense through the suppression of anti-inflammatory effects of glucocorticoids. This lymphokine and the JAB1 protein form a complex in the cytosol near the peripheral plasma membrane, which may indicate an additional role in integrin signaling pathways. Also acts as a phenylpyruvate tautomerase.

Protein type: Amino Acid Metabolism - phenylalanine; EC 5.3.3.12; Apoptosis; Cytokine; Isomerase; EC 5.3.2.1; Cell development/differentiation; Amino Acid Metabolism - tyrosine

Chromosomal Location of Human Ortholog: 22q11.23

Cellular Component: cell surface; cytoplasm; extracellular region; nucleoplasm; vesicle

Molecular Function: chemoattractant activity; cytokine activity; dopachrome isomerase activity; hematopoietin/interferon-class (D200-domain) cytokine receptor binding; phenylpyruvate tautomerase activity; protein binding; receptor binding

Biological Process: carboxylic acid metabolic process; cell proliferation; cell surface receptor linked signal transduction; leukocyte migration; negative regulation of apoptosis; negative regulation of DNA damage response, signal transduction by p53 class mediator; positive regulation of B cell proliferation; positive regulation of cytokine secretion; positive regulation of fibroblast proliferation; positive regulation of peptidyl-serine phosphorylation; positive regulation of peptidyl-tyrosine phosphorylation; positive regulation of phosphorylation; prostaglandin biosynthetic process

Disease: Rheumatoid Arthritis, Systemic Juvenile

Research Articles on MIF

Similar Products

Product Notes

The MIF mif (Catalog #AAA1272583) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgccgatgt tcatcgtaaa caccaacgtg ccccgcgcct ccgtgccgga cgggttcctc tccgagctca cccagcagct ggcgcaggcc accggcaagc ccccccagta catcgcggtg cacgtggtcc cggaccagct catggccttc ggcggctcca gcgagccgtg cgcgctctgc agcctgcaca gcatcggcaa gatcggcggc gcgcagaacc gctcctacag caagctgctg tgcggcctgc tggccgagcg cctgcgcatc agcccggaca gggtctacat caactattac gacatgaacg cggccaatgt gggctggaac aactccacct tcgcctaa. It is sometimes possible for the material contained within the vial of "MIF, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.