MIA cdna clone
MIA cDNA Clone
Gene Names
MIA; CD-RAP
Synonyms
MIA; MIA cDNA Clone; MIA cdna clone
Sequence
atggcccggtccctggtgtgccttggtgtcatcatcttgctgtctgccttctccggacctggtgtcaggggtggtcctatgcccaagctggctgaccggaagctgtgtgcggaccaggagtgcagccaccctatctccatggctgtggcccttcaggactacatggcccccgactgccgattcctgaccattcaccggggccaagtggtgtatgtcttctccaagctgaagggccgtgggcggctcttctggggaggcagcgttcagggagattactatggagatctggctgctcgcctgggctatttccccagtagcattgtccgagaggaccagaccctgaaacctggcaaagtcgatgtgaagacagacaaatgggatttctactgccagtga
Sequence Length
396
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment
NCBI and Uniprot Product Information
NCBI GI #
NCBI GeneID
Molecular Weight
6,361 Da
NCBI Official Full Name
Homo sapiens melanoma inhibitory activity, mRNA
NCBI Official Synonym Full Names
melanoma inhibitory activity
NCBI Official Symbol
MIA
NCBI Official Synonym Symbols
CD-RAP
NCBI Protein Information
melanoma-derived growth regulatory protein
UniProt Protein Name
Melanoma-derived growth regulatory protein
Protein Family
UniProt Gene Name
MIA
UniProt Entry Name
MIA_HUMAN
Uniprot Description
MIA: Elicits growth inhibition on melanoma cells in vitro as well as some other neuroectodermal tumors, including gliomas. Belongs to the MIA/OTOR family.
Protein type: Secreted, signal peptide; Cell adhesion; Secreted
Chromosomal Location of Human Ortholog: 19q13.2
Cellular Component: extracellular space
Biological Process: cell proliferation
Research Articles on MIA
Similar Products
Product Notes
The MIA mia (Catalog #AAA1268266) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggcccggt ccctggtgtg ccttggtgtc atcatcttgc tgtctgcctt ctccggacct ggtgtcaggg gtggtcctat gcccaagctg gctgaccgga agctgtgtgc ggaccaggag tgcagccacc ctatctccat ggctgtggcc cttcaggact acatggcccc cgactgccga ttcctgacca ttcaccgggg ccaagtggtg tatgtcttct ccaagctgaa gggccgtggg cggctcttct ggggaggcag cgttcaggga gattactatg gagatctggc tgctcgcctg ggctatttcc ccagtagcat tgtccgagag gaccagaccc tgaaacctgg caaagtcgat gtgaagacag acaaatggga tttctactgc cagtga. It is sometimes possible for the material contained within the vial of "MIA, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.Precautions
All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.Disclaimer
Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.Item has been added to Shopping Cart
If you are ready to order, navigate to Shopping Cart and get ready to checkout.
