MFSD5 cdna clone
MFSD5 cDNA Clone
Gene Names
MFSD5; hsMOT2
Synonyms
MFSD5; MFSD5 cDNA Clone; MFSD5 cdna clone
Sequence
atgctggtgactgcctaccttgcttttgtaggcctcctggcctcctgcctggggctggaactgtcaagatgccgggctaaaccccctggaagggcctgcagcaatccctccttccttcggtttcaactggacttctatcaggtctacttcctggccctggcagctgattggcttcaggccccctacctctataaactctaccagcattactacttcctggaaggtcaaattgccatcctctatgtctgtggccttgcctctacagtcctctttggcctagtggcctcctcccttgtggattggctgggtcgcaagaattcttgtgtcctcttctccctgacttactcactatgctgcttaaccaaactctctcaagactactttgtgctgctagtggggcgagcacttggtgggctgtccacagccctgctcttctcagccttcgaggcctggtatatccatgagcacgtggaacggcatgacttccctgctgagtggatcccagctacctttgctcgagctgccttctggaaccatgtgctggctgtagtggcaggtgtggcagctgaggctgtagccagctggatagggctggggcctgtagcgccctttgtggctgccatccctctcctggctctggcaggggccttggcccttcgaaactggggggagaactatgaccggcagcgtgccttctcaaggacctgtgctggaggcctgcgctgcctcctgtcggaccgccgcgtgctgctgttgggcaccatacaagctctatttgagagtgtcatcttcatctttgtcttcctctggacacctgtgctggacccacacggggcccctctgggcattatcttctccagcttcatggcagccagcctgcttggctcttccctgtaccgtatcgccacctccaagaggtaccaccttcagcccatgcacctgctgtcccttgctgtgctcatcgtcgtcttctctctcttcatgttgactttctctaccagcccaggccaggagagtccggtggagtccttcatagcctttctacttattgagttggcttgtggattatactttcccagcatgagcttcctacggagaaaggtgatccctgagacagagcaggctggtgtactcaactggttccgggtacctctgcactcactggcttgcctagggctccttgtcctccatgacagtgatcgaaaaacaggcactcggaatatgttcagcatttgctctgctgtcatggtgatggctctgctggcagtggtgggactcttcaccgtggtaaggcatgatgctgagctgcgggtaccttcacctactgaggagccctatgcccctgagctgtaa
Sequence Length
1353
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment
NCBI and Uniprot Product Information
NCBI GI #
NCBI GeneID
Molecular Weight
61,504 Da
NCBI Official Full Name
Homo sapiens major facilitator superfamily domain containing 5, mRNA
NCBI Official Synonym Full Names
major facilitator superfamily domain containing 5
NCBI Official Symbol
MFSD5
NCBI Official Synonym Symbols
hsMOT2
NCBI Protein Information
molybdate-anion transporter
UniProt Protein Name
Molybdate-anion transporter
Protein Family
UniProt Gene Name
MFSD5
UniProt Synonym Gene Names
hsMOT2
UniProt Entry Name
MFSD5_HUMAN
Uniprot Description
MFSD5: Belongs to the major facilitator superfamily. 2 isoforms of the human protein are produced by alternative splicing.
Protein type: Membrane protein, integral; Membrane protein, multi-pass
Chromosomal Location of Human Ortholog: 12q13.13
Cellular Component: membrane
Molecular Function: protein binding
Similar Products
Product Notes
The MFSD5 mfsd5 (Catalog #AAA1277500) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgctggtga ctgcctacct tgcttttgta ggcctcctgg cctcctgcct ggggctggaa ctgtcaagat gccgggctaa accccctgga agggcctgca gcaatccctc cttccttcgg tttcaactgg acttctatca ggtctacttc ctggccctgg cagctgattg gcttcaggcc ccctacctct ataaactcta ccagcattac tacttcctgg aaggtcaaat tgccatcctc tatgtctgtg gccttgcctc tacagtcctc tttggcctag tggcctcctc ccttgtggat tggctgggtc gcaagaattc ttgtgtcctc ttctccctga cttactcact atgctgctta accaaactct ctcaagacta ctttgtgctg ctagtggggc gagcacttgg tgggctgtcc acagccctgc tcttctcagc cttcgaggcc tggtatatcc atgagcacgt ggaacggcat gacttccctg ctgagtggat cccagctacc tttgctcgag ctgccttctg gaaccatgtg ctggctgtag tggcaggtgt ggcagctgag gctgtagcca gctggatagg gctggggcct gtagcgccct ttgtggctgc catccctctc ctggctctgg caggggcctt ggcccttcga aactgggggg agaactatga ccggcagcgt gccttctcaa ggacctgtgc tggaggcctg cgctgcctcc tgtcggaccg ccgcgtgctg ctgttgggca ccatacaagc tctatttgag agtgtcatct tcatctttgt cttcctctgg acacctgtgc tggacccaca cggggcccct ctgggcatta tcttctccag cttcatggca gccagcctgc ttggctcttc cctgtaccgt atcgccacct ccaagaggta ccaccttcag cccatgcacc tgctgtccct tgctgtgctc atcgtcgtct tctctctctt catgttgact ttctctacca gcccaggcca ggagagtccg gtggagtcct tcatagcctt tctacttatt gagttggctt gtggattata ctttcccagc atgagcttcc tacggagaaa ggtgatccct gagacagagc aggctggtgt actcaactgg ttccgggtac ctctgcactc actggcttgc ctagggctcc ttgtcctcca tgacagtgat cgaaaaacag gcactcggaa tatgttcagc atttgctctg ctgtcatggt gatggctctg ctggcagtgg tgggactctt caccgtggta aggcatgatg ctgagctgcg ggtaccttca cctactgagg agccctatgc ccctgagctg taa. It is sometimes possible for the material contained within the vial of "MFSD5, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.Precautions
All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.Disclaimer
Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.Item has been added to Shopping Cart
If you are ready to order, navigate to Shopping Cart and get ready to checkout.
