Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

MED17 cdna clone

MED17 cDNA Clone

Gene Names
MED17; CRSP6; CRSP77; DRIP80; TRAP80
Synonyms
MED17; MED17 cDNA Clone; MED17 cdna clone
Ordering
For Research Use Only!
Sequence
atgtccggggtgcgcgcagtgcggatcagcatcgaatcggcctgcgagaagcaggtccatgaggtgggcctggatggcaccgagacgtacctgcccccgctgtccatgtcgcagaatctggcgcgtctggcccagcggatagacttcagccagggttcgggctccgaggaggaggaggcggcggggaccgagggggacgcgcaggactggccgggcgccgggtccagcgcagaccaggacgacgaggaaggagtggtaaaatttcagccttccctttggccttgggactcagtgaggaacaatttgagaagtgccctgacagagatgtgtgttctctatgatgttctcagtattgttagggataaaaaatttatgactcttgatcctgtctctcaggatgcacttcctccaaaacagaatcctcagacgttgcaattgatatctaaaaagaagtcacttgctggagcagcacaaatcttattgaagggggcagaaagactgactaaatcagttaccgaaaaccaagaaaacaagctacaaagagacttcaattctgagcttttgcgattacggcaacactggaaacttcgaaaagttggagataaaattctcggagatctgagctacagaagtgcaggatctctctttcctcatcatggtacatttgaagtaataaagaatacagatctcgatctggataaaaagatacctgaagattactgtcctcttgatgtccaaattcctagtgatttagaggggtctgcatatatcaaggtttcaatacaaaaacaggctccagatataggtgacctcggcacagttaacctcttcaaacgacctttgcccaaatccaaaccaggttccccacattggcagacaaaattagaagcggcacagaatgttctcttatgtaaagaaatttttgcacagctctctcgggaagctgttcaaattaaatcacaagtccctcacattgtggtgaaaaaccagattatctctcagccctttccgagcttgcagttatctatttctttgtgccattcctcaaatgataagaaatcccaaaaatttgctactgagaagcaatgtccggaggaccacctttatgtcctagagcataatttgcatctactgattagagagtttcataaacagaccttgagttccatcatgatgcctcatccagcaagtgcaccttttggccacaagagaatgagactttcgggtcctcaagcttttgataaaaatgaaattaattcattacagtccagtgaagggcttctggaaaaaataattaaacaagcaaagcatatttttctaaggagtagagctgctgcaaccattgacagcttagcaagccgaattgaggatcctcagatacaggctcattggtcaaatatcaatgatgtttatgaatctagtgtgaaagttttaatcacatcacaaggctatgaacaaatatgcaagtccattcaactgcaattgaatattggagttgagcagattcgagttgtacatagagatggaagagtaattacactgtcttatcaggagcaggagctacaggattttcttctgtctcagatgtcacagcaccaggtacatgcagttcagcaactcgccaaggttatgggctggcaagtactgagcttcagtaatcatgtgggacttggacctatagagagcattggtaatgcatctgccatcacggtggcctccccaagtggtgactatgctatttcagttcgtaatggacctgaaagtggcagcaagattatggttcagtttcctcgtaaccaatgtaaagaccttccaaaaagtgatgttttacaagataacaaatggagtcatcttcgtgggccattcaaagaagttcagtggaataaaatggaaggtcgaaattttgtttataaaatggagctgcttatgtctgcacttagcccttgtctactatga
Sequence Length
1956
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
15,951 Da
NCBI Official Full Name
Homo sapiens mediator complex subunit 17, mRNA
NCBI Official Synonym Full Names
mediator complex subunit 17
NCBI Official Symbol
MED17
NCBI Official Synonym Symbols
CRSP6; CRSP77; DRIP80; TRAP80
NCBI Protein Information
mediator of RNA polymerase II transcription subunit 17
UniProt Protein Name
Mediator of RNA polymerase II transcription subunit 17
UniProt Gene Name
MED17
UniProt Synonym Gene Names
ARC77; CRSP6; DRIP77; DRIP80; TRAP80; ARC77; CRSP complex subunit 6; Trap80; DRIP80
UniProt Entry Name
MED17_HUMAN

NCBI Description

The activation of gene transcription is a multistep process that is triggered by factors that recognize transcriptional enhancer sites in DNA. These factors work with co-activators to direct transcriptional initiation by the RNA polymerase II apparatus. The protein encoded by this gene is a subunit of the CRSP (cofactor required for SP1 activation) complex, which, along with TFIID, is required for efficient activation by SP1. This protein is also a component of other multisubunit complexes e.g. thyroid hormone receptor-(TR-) associated proteins which interact with TR and facilitate TR function on DNA templates in conjunction with initiation factors and cofactors. [provided by RefSeq, Jul 2008]

Uniprot Description

MED17: Component of the Mediator complex, a coactivator involved in the regulated transcription of nearly all RNA polymerase II-dependent genes. Mediator functions as a bridge to convey information from gene-specific regulatory proteins to the basal RNA polymerase II transcription machinery. Mediator is recruited to promoters by direct interactions with regulatory proteins and serves as a scaffold for the assembly of a functional preinitiation complex with RNA polymerase II and the general transcription factors. Defects in MED17 are the cause of microcephaly postnatal progressive with seizures and brain atrophy (MCPHSBA). It is a disorder characterized by postnatal progressive microcephaly and severe developmental retardation associated with cerebral and cerebellar atrophy. Infants manifest swallowing difficulties leading to failure to thrive, jitteriness, poor visual fixation, truncal arching, seizures. There is no acquisition of developmental milestones and patients suffer from marked spasticity and profound retardation. Progressive microcephaly becomes evident few months after birth. Belongs to the Mediator complex subunit 17 family. 2 isoforms of the human protein are produced by alternative splicing.

Protein type: Transcription, coactivator/corepressor; Nuclear receptor co-regulator

Chromosomal Location of Human Ortholog: 11q14

Cellular Component: membrane; nucleoplasm; nucleus; Srb-mediator complex; transcription factor complex

Molecular Function: protein binding; receptor activity; thyroid hormone receptor binding; transcription coactivator activity; transcription cofactor activity

Biological Process: androgen receptor signaling pathway; positive regulation of transcription from RNA polymerase II promoter; positive regulation of transcription, DNA-dependent; regulation of transcription from RNA polymerase II promoter; steroid hormone receptor signaling pathway; transcription initiation from RNA polymerase II promoter

Disease: Microcephaly, Postnatal Progressive, With Seizures And Brain Atrophy

Research Articles on MED17

Similar Products

Product Notes

The MED17 med17 (Catalog #AAA1267233) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgtccgggg tgcgcgcagt gcggatcagc atcgaatcgg cctgcgagaa gcaggtccat gaggtgggcc tggatggcac cgagacgtac ctgcccccgc tgtccatgtc gcagaatctg gcgcgtctgg cccagcggat agacttcagc cagggttcgg gctccgagga ggaggaggcg gcggggaccg agggggacgc gcaggactgg ccgggcgccg ggtccagcgc agaccaggac gacgaggaag gagtggtaaa atttcagcct tccctttggc cttgggactc agtgaggaac aatttgagaa gtgccctgac agagatgtgt gttctctatg atgttctcag tattgttagg gataaaaaat ttatgactct tgatcctgtc tctcaggatg cacttcctcc aaaacagaat cctcagacgt tgcaattgat atctaaaaag aagtcacttg ctggagcagc acaaatctta ttgaaggggg cagaaagact gactaaatca gttaccgaaa accaagaaaa caagctacaa agagacttca attctgagct tttgcgatta cggcaacact ggaaacttcg aaaagttgga gataaaattc tcggagatct gagctacaga agtgcaggat ctctctttcc tcatcatggt acatttgaag taataaagaa tacagatctc gatctggata aaaagatacc tgaagattac tgtcctcttg atgtccaaat tcctagtgat ttagaggggt ctgcatatat caaggtttca atacaaaaac aggctccaga tataggtgac ctcggcacag ttaacctctt caaacgacct ttgcccaaat ccaaaccagg ttccccacat tggcagacaa aattagaagc ggcacagaat gttctcttat gtaaagaaat ttttgcacag ctctctcggg aagctgttca aattaaatca caagtccctc acattgtggt gaaaaaccag attatctctc agccctttcc gagcttgcag ttatctattt ctttgtgcca ttcctcaaat gataagaaat cccaaaaatt tgctactgag aagcaatgtc cggaggacca cctttatgtc ctagagcata atttgcatct actgattaga gagtttcata aacagacctt gagttccatc atgatgcctc atccagcaag tgcacctttt ggccacaaga gaatgagact ttcgggtcct caagcttttg ataaaaatga aattaattca ttacagtcca gtgaagggct tctggaaaaa ataattaaac aagcaaagca tatttttcta aggagtagag ctgctgcaac cattgacagc ttagcaagcc gaattgagga tcctcagata caggctcatt ggtcaaatat caatgatgtt tatgaatcta gtgtgaaagt tttaatcaca tcacaaggct atgaacaaat atgcaagtcc attcaactgc aattgaatat tggagttgag cagattcgag ttgtacatag agatggaaga gtaattacac tgtcttatca ggagcaggag ctacaggatt ttcttctgtc tcagatgtca cagcaccagg tacatgcagt tcagcaactc gccaaggtta tgggctggca agtactgagc ttcagtaatc atgtgggact tggacctata gagagcattg gtaatgcatc tgccatcacg gtggcctccc caagtggtga ctatgctatt tcagttcgta atggacctga aagtggcagc aagattatgg ttcagtttcc tcgtaaccaa tgtaaagacc ttccaaaaag tgatgtttta caagataaca aatggagtca tcttcgtggg ccattcaaag aagttcagtg gaataaaatg gaaggtcgaa attttgttta taaaatggag ctgcttatgt ctgcacttag cccttgtcta ctatga. It is sometimes possible for the material contained within the vial of "MED17, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.